| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
RESEARCH |
1 Laboratoire de Physiologie Materno-Fœtale, Département des Sciences Biologiques, Université du Québec à Montréal, Montréal, Québec, Canada H3C 3P82 Centre de Recherche BioMed, Université du Québec à Montréal, Montréal, Québec, Canada H3C 3P83 Hôpital Saint-François d'Assise, Centre Hospitalier Universitaire de Québec, Québec, Québec, Canada G1R 2J64 Hôpital St-Luc, Centre Hospitalier de l'Université de Montréal, Montréal, Canada H2X 3J45 Hôpital Ste-Justine, Montréal, Québec, Canada H3T 1C5
Correspondence should be addressed to J Lafond at Laboratoire de Physiologie Materno-Fœtale, Centre de Recherche BioMed, Université du Québec à Montréal, C.P. 8888, Succursale Centre-Ville, Montréal, Canada H3C 3P8; Email: lafond.julie{at}uqam.ca
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionMaterials and MethodsDeclaration of interestFundingAcknowledgementsReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsDeclaration of interestFundingAcknowledgementsReferences |
|---|
Human placental cells express many lipoprotein receptors that can bind many lipoproteins such as the LDL receptor (LDLR; Cummings et al. 1982), the LDL receptor-related protein (LRP; Gafvels et al. 1992), the VLDL receptor (VLDL receptor; Wittmaack et al. 1995), the scavenger receptors (Bonet et al. 1995, Cao et al. 1997, Lafond et al. 1999), and the lectin-like oxidized LDL receptor-1 (OLR1; Yoshida et al. 1998). This latter one was recently cloned by Sawamura et al. (1997) and Moriwaki et al. (1998), and it can bind, internalize, and degrade the oxidized LDL (ox-LDL). OLR1 is a type II membrane glycoprotein belonging to C-type lectin family with a short N-terminal cytoplasmic tail and a long C-terminal extracellular domain (Kita et al. 2001). It has a molecular weight of 47 kDa and is initially synthesized as a 40 kDa precursor protein (pre-OLR1), that has a minimal N-linked high-mannose-type carbohydrate, which is further glycosylated into the mature protein and transported to the cell surface (Kataoka et al. 2000). OLR1 binds ox-LDL, delipidated, and solubilized ox-LDL, indicating that oxidatively modified apolipoprotein B-100 (apo-B) or some oxidized phospholipids firmly attached to the apo-B might be ligands of OLR1 (Moriwaki, et al. 1998). In addition, this receptor is upregulated by pro-atherogenic conditions, such as dyslipidemia, hypertension, and diabetes (Nagase et al. 1997, Kume et al. 1998, Chen et al. 2000a, 2000b, 2001).
During human pregnancy, the maternal lipoprotein profiles are greatly modified (Herrera 2002). Fundamentally, pregnancy is associated with an oxidative stress state arising from the increasing metabolic activity of placental mitochondria and the decreasing scavenging by antioxidants (Wisdom et al. 1991). Products of lipid peroxidation have been detected in human placenta; LDLs are one of the main targets for lipid peroxidation and are converted to their oxidized form (Fialova et al. 2002). This process represents a key step in the development of atherosclerosis, since several studies showed that LDLs become atherogenic when they are converted to ox-LDL (Steinberg 1997, Witztum & Horkko 1997). Because they have reduced affinity for the native LDLR, smaller and denser particles are considered to be more atherogenic. Thus, they are longer retained in the circulation, and become more inclined to oxidation, maybe because they contain less intrinsic antioxidants (Dejager et al. 1993, Rajman et al. 1999). ox-LDL becomes a ligand for scavenger receptors, including OLR1.
Affecting 3–7% of pregnant women, gestational diabetes mellitus (GDM) is characterized by endothelial dysfunction and reactive nitrogen and oxygen species, which contribute to the progression of diabetes (Honing et al. 1998, Rosen et al. 2001). In diabetes, reactive oxygen species (ROS), including superoxide, are thought to be produced as a result of prolonged periods of exposure to hyperglycemia, known to cause non-enzymatic glycation of plasma proteins (Tames et al. 1992). In addition, GDM is generally associated with disturbances in lipoprotein metabolism with a tendency toward hypercholesterolemia (Taskinen 1990). During pregnancy, women with GDM have higher serum TG concentrations, but lower HDL cholesterol concentrations than normal pregnant women (Koukkou et al. 1996).
We hypothesize that maternal lipid profile could modify placental expression of OLR1. Therefore, this study was designed to characterize the metabolic modifications of circulating lipids on the expression and localization of OLR1 in human term placenta of normal, hypercholesterolemic, and GDM pregnancies, and potentially correlate the modifications with BMI and some inflammatory cytokines. Thus, this study will provide better understanding of the regulation of important receptor involved in oxidized cholesterol metabolism and pregnancy-related disorders/pathologies, in which the lipid profile may be disturbed.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsDeclaration of interestFundingAcknowledgementsReferences |
|---|
|
|
|
|
(TNF) was done. These cytokines are highly expressed in placenta, principally IL1B. Figure 1C shows the IL1B and TNF concentrations in human term placenta in relation to maternal plasmatic total cholesterol level at term. Our results demonstrate that these cytokines were not influenced by maternal plasmatic total cholesterol level, were neither influenced nor by maternal pre-pregnancy BMI (Fig. 2B). Finally, in HC women, placental IL1B level was influenced by weight gain during pregnancy (data not shown). Specifically, an increase of ±65% is observed between women who gained >18 kg compared with women with normal weight gain (11–18 kg; 235.2±38.03 vs 139.2±11.54 respectively). No difference was showed for TNF related to weigh gain (data not shown).
Protein expression of OLR1 in syncytiotrophoblast membranes
The expression of OLR1 was evaluated by western blot in syncytiotrophoblast plasma membranes (BPM and BBM), isolated form fresh placenta. Figure 3 shows representative western blot of the expression of OLR1 in BPM, BBM, syncytiotrophoblast cells, and total protein from placental tissue. Expression of OLR1 protein, which has a molecular weight of 47 kDa, was detected in both placental membranes, in syncytiotrophoblastic cells and in total protein extract from placenta.
|
|
|
|
|
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsDeclaration of interestFundingAcknowledgementsReferences |
|---|
Abnormally high plasma lipid concentration is thought to be an important pathogenic factor, principally in atherogenesis. It is known that OLR1 expression is increased in case of hypertension, atherosclerosis, and hyperlipidemia in vivo (Mehta et al. 2006). A study using apo-E knockout mice, a model for spontaneous hypercholesterolemia, the OLR1 expression is reduced by feeding mice with a HMG-CoA reductase inhibitor (Chen et al. 2006), which decreases LDL cholesterol level and reduces the formation and uptake of ox-LDL (Chen et al. 2000a, 2000b). Our data are in accordance with these observations since we showed a positive correlation between plasma total cholesterol, LDL cholesterol, and apo-B100 levels with placental protein expression of OLR1. In contrast to non-pregnant women, there is a physiological change in plasma lipids and an increased oxidative turnover that is controlled by countervailing anti-oxidative mechanisms in healthy pregnant women (Toescu et al. 2002). In response to the high demand by the fetus, there is an increase production of ROS by the placenta during pregnancy. On the other hand, placenta is a source of an anti-oxidative enzyme and hormone system that controls placental lipid peroxidation in healthy pregnancy (Gitto et al. 2002). Many studies reported higher levels of placental lipid peroxides in pre-eclampsia than in normal pregnancies (Walsh & Wang 1993, Gratacos et al. 1998, Serdar et al. 2002), suggesting that placental tissues could be the source of elevated levels of serum lipid peroxides. Finally, it has been reported that OLR1 was the principal scavenger receptor responsible for the uptake of ox-LDL in placental cells (Pavan et al. 2004). Thus, the high level of OLR1 placental protein expression can be explained by the enhancement of oxidative stress in HC women. Obviously, the importance of oxidative stress in pregnant women and the lack of knowledge in this population justify pursuing studies in this particular field.
In this study, we demonstrated that pre-pregnancy BMI significantly increased placental OLR1 protein expression in LC women. We first hypothesized that this increase could be attributed to the inflammatory status observed in obesity (Chen 2006). It is well known that adipose tissue is a highly active endocrine organ secreting a number of hormones that alter the circulation of metabolites, cytokines, and growth factors (Grundy 2004, Havel 2004). Thus, obese women are more likely than normal weight women to enter pregnancy in a subclinical inflammatory state since increases in body fat are associated with elevated cytokine levels and inflammation (Greenberg & Obin 2006). Surprisingly, our data showed no difference for both IL1B and TNF in relation to maternal BMI. However, this effect could be attributed to the fact that maternal adiposity could also produced a hypoxic state when glycosylated hemoglobin levels are increased and affinity for oxygen is reduced, decreasing oxygen transfer to the uterus and impairing placentation (King 2006). Thus, many molecules related to oxidative stress can induce the expression of OLR1, such as isoprostanes, which are prostaglandin isomers formed by free radical peroxidation of arachidonic acid presents in phospholipids (Sakurai & Sawamura 2003). Among these isoprostanes, 8-iso-prostaglandin F2, a well-known marker of oxidative stress (Sakurai & Sawamura 2003), has the potential to increase the uptake of oxidized LDL and the expression of OLR1 in human placenta choriocarcinoma JAR cells (Halvorsen et al. 2001). Some of our data showed that maternal weight gain had no effect on placental OLR1 protein expression. In contrast, our results demonstrated an increase in IL1B content for HC women with normal weight gain (11–18 kg) compared with HC women with lowest weight gain (<11 kg). The precise relationship between this cytokines and maternal weight gain remains unclear and further investigations will be necessary.
The present study demonstrates the localization of OLR1 in both maternal BBM and fetal BPM sides of syncytiotrophoblasts. The binding of ox-LDL with OLR1 induces superoxide generation, inhibits NO production, enhances endothelial adhesiveness for leucocytes, and induces chemokine expression (Cominacini et al. 2000, Li & Mehta 2000). Thus, the presence of OLR1 in both sides of syncytiotrophoblasts may promote apoptosis (Lee et al. 2005). A recent study shows that the functional role of trophoblasts in placental dysfunction results from the localization and the upregulation of OLR1 in pre-eclamptic placenta, which possibly promotes apoptotic activity (Lee et al. 2005). Since OLR1 is a receptor for ox-LDL, a highly atherogenic lipoprotein, physiological functions of placental cells may be altered. Thus, maternal hypercholesterolemia could promote fetal atherosclerosis development via OLR1. Finally, further investigations will be required to understand the precise role of these two binding sites.
GDM induces a state of dyslipidemia consistent with insulin resistance. Indeed, during pregnancy, GDM women had higher plasma TG concentrations (Butte 2000). In normal pregnancy, the higher concentration of estrogens and insulin resistance are considered to be responsible for the hypertriglyceridemia (Butte 2000), while in GDM women, increased insulin resistance may account to the rise in TG concentration (Koukkou et al. 1996). In this study, we found an increase in TG concentration at delivery and a decrease in total and LDL cholesterol in cord blood of GDM women. A novel study shows that GDM increased the LDL susceptibility to oxidation, a susceptibility due to diabetes per se, as well as the increase in incidence of obesity found in these women (Sanchez-Vera et al. 2007). This fact is in accordance with our results, since we found that GDM women had higher BMI than control ones. It is known that hyperlipidemia is exaggerated in obese pregnant women (Ramsay et al. 2002). This fact could be attributed to the inability of insulin to suppress whole-body lipolysis, leading to a marked increase in plasma free fatty acids in obese women compared with control women (Xiang et al. 1999). The decrease in total cholesterol and LDL cholesterol concentrations, found in cord blood of babies from GDM women, may be attributed to a decrease in the placental blood flow and placental damage due to lipid peroxides generated by the increased LDL oxidation. As a result, this would compromise the supply of nutriment toward the fetus. An important finding of our study is that GDM increases placental OLR1 protein expression without affecting mRNA expression levels. This result, for the protein expression, is in accordance with other studies that demonstrated the increase in OLR1 expression in different tissues of diabetic subjects. It has been reported that OLR1 expression is increased by glucose both in macrophage and endothelial cells (Li et al. 2003, 2004). Effectively, diabetes is characterized by the presence of an important oxidative stress, endothelial dysfunction, and increased expression of endothelial molecules in the inflammatory cells (Stevens 2005). Thus, this effect could be attributed to the maternal inflammatory status; in a recent study, an increase in cytokines concentration in maternal blood with GDM was observed (Heitritter et al. 2005). This finding agrees with our results where we demonstrated a significant increase in two central mediators of inflammatory reaction, IL1B and TNF, in placenta of women with GDM. Finally, we show that this increase is more pronounced for placental IL1B, while this cytokine is associated with the risk of developing type 2 diabetes (Spranger et al. 2003). In fact, several studies show that proinflammatory cytokines regulate the expression of OLR1 (Kume et al. 2000, Chiba et al. 2001, Hofnagel et al. 2006). A study using smooth muscle cells showed that strong co-distribution of proinflammatory cytokines, IL1A and IL1B, and TNF with OLR1 expression promotes atherosclerosis lesions (Hofnagel et al. 2006). Moreover, pregnancy induces inflammatory changes characterized by the activation of peripheral blood leucocytes (Sacks et al. 1998), and the production of pro-anti-inflammatory cytokines such as IL6 and TNF. Finally, this increase in OLR1 expression observed in women with GDM could be regulated by a post-transcriptional mechanism implying these cytokines. Finally, babies delivered under GDM were normal, resulting in the maternal intake of insulin during the third trimester of pregnancy (Challier et al. 1986). To conclude, all of these facts are in accordance with our data, where we found that placental protein expression of OLR1 is increased in women with GDM.
In summary, our results corroborate the importance of the maternal lipid profile during pregnancy. Thus, maternal hypercholesterolemia, as well as GDM, could promote fetal atherosclerosis development via an upregulation of placental expression of OLR1. In addition, we reported for the first time the presence of OLR1 in both maternal and fetal sides of syncytiotrophoblasts. Taking together, these data suggest that the post-transcriptional modulation of placental protein expression OLR1 by maternal lipid profile disturbance or pathologies during pregnancy can ultimately influence fetal growth and development.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsDeclaration of interestFundingAcknowledgementsReferences |
|---|
Blood samples
Blood samples were collected at delivery, from the mother and the cord blood. The blood samples were collected in 10 ml gel Vacutainer tube gel (BD, Oakville, Canada) and centrifuged for 15 min at 3500 g, less than 1 h after delivery. Plasma samples were kept at –20 °C until analysis. The placentas, from vaginal delivery, were obtained from the collaborating hospital and immediately immersed in Dulbecco's modified Eagle's medium (Sigma) containing a mixture of antibiotic (penicillin, streptomycin, and neomycin; Invitrogen) and NaHCO3. After the removal of the amnion, chorion and decidual layers, the placental tissue was cut into sections of 5 cm2 and immediately frozen in liquid nitrogen and kept at –80 °C until use.
Lipid assays
The plasma levels of total cholesterol and LDL, HDL, VLDL, and TG were individually measured using the Unicel 36 DX600 Synchron Clinical System (Beckman-Coulter, Mississauga, ON, Canada), at the Clinical Biochemistry Service of Hôpital Saint-François d'Assise, Québec (QC, Canada).
Total proteins extraction
The placental frozen tissue samples were washed three to four times with 0.9% cold NaCl solution containing anti-protease (1 µM leupeptin, 1.46 µM pepstatin, and 2 µg/ml aprotinin) to remove blood from tissue. The tissue (1 g) was homogenized using a Polytron tissue homogeniser PT 3000 (Brinkmann, Canada) in 1 ml ice-cold hypertonic buffer (125 mM Tris–HCl, pH 8.0, 2 mM CaCl2, 1.4% (v/v) Triton X-100, 1 µM leupeptin, 1.46 µM pepstatin, 2 µg/ml aprotinin, and 1 mM phenylmethylsulphonylfluoride (PMSF)). The homogenate was kept on ice for 30 min, centrifuged at 10 000 g for 25 min at 4 °C, the supernatant was collected, and stored at –80 °C until used. The protein concentration content was determined by spectrophotometric quantification using the bicinchoninic acid reagent (Pierce, Brockville, ON, Canada) with BSA as standard.
Purification of syncytiotrophoblast BBM and BPM
Briefly, membranes were purified from placental tissues collected from fresh human placentas obtained from full-term normal vaginal delivery (CHUM, Pavilion St-Luc, QC, Canada). After the removal of the amnion, chorion and decidual layers, the tissues were minced and stirred for 45 min in 10 mM Tris–HEPES (pH 7.4) containing 270 mM mannitol, 0.1 mM PMSF, 1 mg/ml benzamidin, and 10 mM leupeptin. The membranes were purified, as described by our laboratory (Lafond et al. 1988) with some modifications (Robidoux et al. 1998).
Western blot analyses of OLR1
Total placental proteins (150 µg for total placental protein and 30 µg for syncytiotrophoblastic membranes) were solubilized n a sample buffer (4% SDS, 30 mM dithiotreitol, 10% β-mercaptoethanol, 0.25 M sucrose, 0.01 M EDTA–Na2, and 0.075% bromophenol blue) and heated at 95 °C for 5 min. The proteins were resolved in a 8% SDS-PAGE and electroblotted to PDVF membrane (Millipore, Cambridge, ON, Canada) at 20 V for 40 min. Membranes were blocked overnight at 4 °C in TBS-T (20 mM Tris base, pH 7.6, 137 mM NaCl, and 0.1% Tween-20) containing 5% skimmed milk. Thereafter, the membranes were washed three times with TBS-T and incubated with anti-human OLR1 goat polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 1/1000 in TBS-T/5% BSA and 1% skimmed milk), or human GAPDH mouse MAB (Chemicon International, Temecula, CA, USA; 1/5000 in TBS-T/5% BSA) for 90 min at room temperature. Blots were washed three times with TBS-T, and probed with horseradish peroxidase-conjugated secondary antibodies, for OLR1, anti-goat IgG (1/6500 TBS-T 5% BSA and 1% skimmed milk) and for GAPDH anti-mouse IgG (1/3000 TBS-T 5% skimmed milk; Chemicon International) for 90 min at room temperature. Blots were then washed three times with TBS-T and the detection was performed using the BM chemiluminescence system (Roche Diagnostics) and visualized by autoradiography (Hyperfilm ECL, GE Healthcare, Baie d'Urfée, QC, Canada). The PDVF membranes were stripped with a stripping solution (12 M HCl (pH 2.0) 25 mM glycine, and 1% SDS) for 10 min at room temperature. Thereafter, the membranes were rinsed three times with a washing solution (1 M Na2HPO4, 1 M NaH2PO4 (pH 7.2), and 9 g/l NaCl) for 5 min and blocked for 1 h. The membranes were then ready to be reprobed with GAPDH for loading standardization. We normalized data with a control sample that served to express data as percentage of control. For semi-quantitative analyses of the bands, the film was digitized and analyzed by the Quantity One Software (Bio-Rad Laboratories).
RNA analysis
Total RNA was extracted from placental tissue using the High Pure RNA Tissue Kit (Roche Diagnostics). The RT was performed in a 20 µl reaction containing 0.5 µg total RNA using the Omniscript kit (Qiagen) and the Oligo-dT primers (Roche Diagnostics) according to the manufacturer's instructions. The real-time PCRs were realized using the 480 SYBR Green I Master (Roche Diagnostics) on a LightCycler 480 Instrument (Roche Diagnostics). The PCRs were performed using 0.5 µM of both sense and antisense primers, for 55 cycles to ensure exponential amplification phase of the targeted genes. Primer sequences designed for human OLR1 were: (5'–3') (sense) TTACTCTCCATGGTGGTGGTGCC and (antisense) AGCTTTCTTCTGCTTGTTGCC. Human 18S primers, as reference gene, were: (5'–3') (sense) AGAGCTAATACATGCCGAC and (antisense) AGTTGATAGGGCAGACG.
Immunohistochemistry
An immunohistochemistry study was performed to investigate the localization of OLR1 protein. We used appropriate placental tissues from fresh placentas. After the removal of the amnion, chorion and decidual layers, the placental tissue was cut into sections of 5x5x5 mm, embedded in cold (4 °C) Tissue-tek OCT (Electron Microscopy Sciences, Hatfield, PA, USA) and immediately frozen in isopentane at –80 °C (Sigma–Aldrich). The sections were stored at –80 °C until further processing. For immunohistochemical staining, frozen sections (8 µm thick) were mounted onto SuperFrost Plus glass slides (Fisher Scientific, Pittsburgh, PA, USA) and air-dried overnight. The sections were then fixed with freshly prepared cold 4% paraformaldehyde and 0.2% picric acid in PBS for 20 min at 4 °C. To complete fixation, cryosections were air-dried at room temperature. Tissue sections were rinsed with PBS for 3 min and the sections were incubated with permeabilization solution (1% Triton X-100 in PBS) for 30 min at room temperature. The sections were blocked in 0.5% donkey serum and 0.1% Tween-20 for 60 min at room temperature, after quenching endogenous peroxidase activity by exposing slides to ‘Peroxidase Block’ (Kit LSAB+ System-HRP; DAKO, Mississauga, ON, Canada) for 5 min. The sections were then incubated with primary antibodies diluted in blocking solution (Biomeda, Foster City, CA, USA) overnight at 4 °C. The primary antibodies used were goat polyclonal anti-OLR1 antiserum (1:100, Santa Cruz Biotechnology), rabbit polyclonal anti-hCG (1:500, Chemicon), and mouse anti-CD34 (1:1000, NeoMarker, Fremont, CA, USA). To ascertain protein-specific antibody binding, controls (CTL) were performed omitting primary antibodies. Subsequently, they were incubated with endogenous avidin and biotin blocking solutions for 15 min at room temperature each. Tissue sections were incubated with ‘Link’ universal secondary antibody solution (DAKO) for 60 min at room temperature and then with ‘streptavidin–peroxidase’ for 30 min. They were stained with ‘substrate-chromogen solution’ (DAKO), and counterstained with Mayer's hematoxylin (Fluka, Buchs, Switzerland). The sections were viewed and photographed under interference contrast Leitz Diaplan microscope equipped with a Nikon CoolPix 990 camera. Cells having intense brownish staining were considered immunopositive.
Cytokine quantification
Interleukin-1β (IL1B) and TNF concentrations were measured in the total protein fraction extracted from placental tissue, using the Human IL-1 (IL-1b) ELISA Ready-SET-Go! and Human TNF (TNF) ELISA Ready-SET-Go! Kits (eBioscience, San Diego, CA, USA) according to the manufacturer's instructions.
Statistical analyses
Data were expressed as the mean±S.E.M., and analyzed with unpaired Student's t-test at P<0.05 level of significance, to evaluated difference between groups. For the relationship between two variables of the same population, the results are expressed as Spearman's correlation and the curve represent Pearson's linear correlation. All statistical analyses were performed using the Prism software (version 4.0.2, 2004; GraphPad Software, La Jolla, CA, USA).
|
Declaration of interest |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsDeclaration of interestFundingAcknowledgementsReferences |
|---|
|
Funding |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsDeclaration of interestFundingAcknowledgementsReferences |
|---|
|
Acknowledgements |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsDeclaration of interestFundingAcknowledgementsReferences |
|---|
Received 21 February 2008
First decision 7 May 2008
Accepted 2 July 2008
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsDeclaration of interestFundingAcknowledgementsReferences |
|---|
Bonet B, Chait A, Gown AM & Knopp RH 1995 Metabolism of modified LDL by cultured human placental cells. Atherosclerosis 112 125–136.[CrossRef][Web of Science][Medline]
Butte NF 2000 Carbohydrate and lipid metabolism in pregnancy: normal compared with gestational diabetes mellitus. American Journal of Clinical Nutrition 71 1256S–1261S.
Cao G, Garcia CK, Wyne KL, Schultz RA, Parker KL & Hobbs HH 1997 Structure and localization of the human gene encoding SR-BI/CLA-1. Evidence for transcriptional control by steroidogenic factor 1. Journal of Biological Chemistry 272 33068–33076.
Challier JC, Hauguel S & Desmaizieres V 1986 Effect of insulin on glucose uptake and metabolism in the human placenta. Journal of Clinical Endocrinology and Metabolism 62 803–807.
Chen H 2006 Cellular inflammatory responses: novel insights for obesity and insulin resistance. Pharmacological Research 53 469–477.[CrossRef][Web of Science][Medline]
Chen H, Li D, Sawamura T, Inoue K & Mehta JL 2000a Upregulation of LOX-1 expression in aorta of hypercholesterolemic rabbits: modulation by losartan. Biochemical and Biophysical Research Communications 276 1100–1104.[CrossRef][Web of Science][Medline]
Chen M, Kakutani M, Minami M, Kataoka H, Kume N, Narumiya S, Kita T, Masaki T & Sawamura T 2000b Increased expression of lectin-like oxidized low density lipoprotein receptor-1 in initial atherosclerotic lesions of Watanabe heritable hyperlipidemic rabbits. Arteriosclerosis, Thrombosis, and Vascular Biology 20 1107–1115.
Chen M, Nagase M, Fujita T, Narumiya S, Masaki T & Sawamura T 2001 Diabetes enhances lectin-like oxidized LDL receptor-1 (LOX-1) expression in the vascular endothelium: possible role of LOX-1 ligand and AGE. Biochemical and Biophysical Research Communications 287 962–968.[CrossRef][Web of Science][Medline]
Chen J, Li D, Schaefer R & Mehta JL 2006 Cross-talk between dyslipidemia and renin-angiotensin system and the role of LOX-1 and MAPK in atherogenesis studies with the combined use of rosuvastatin and candesartan. Atherosclerosis 184 295–301.[CrossRef][Medline]
Chiba Y, Ogita T, Ando K & Fujita T 2001 PPARgamma ligands inhibit TNF--induced LOX-1 expression in cultured endothelial cells. Biochemical and Biophysical Research Communications 286 541–546.[CrossRef][Web of Science][Medline]
Di Cianni G, Miccoli R, Volpe L, Lencioni C & Del Prato S 2003 Intermediate metabolism in normal pregnancy and in gestational diabetes. Diabetes/Metabolism Research and Reviews 19 259–270.[CrossRef]
Cominacini L, Pasini AF, Garbin U, Davoli A, Tosetti ML, Campagnola M, Rigoni A, Pastorino AM, Lo Cascio V & Sawamura T 2000 Oxidized low density lipoprotein (ox-LDL) binding to ox-LDL receptor-1 in endothelial cells induces the activation of NF-
B through an increased production of intracellular reactive oxygen species. Journal of Biological Chemistry 275 12633–12638.
Cummings SW, Hatley W, Simpson ER & Ohashi M 1982 The binding of high and low density lipoproteins to human placental membrane fractions. Journal of Clinical Endocrinology and Metabolism 54 903–908.
Dejager S, Bruckert E & Chapman MJ 1993 Dense low density lipoprotein subspecies with diminished oxidative resistance predominate in combined hyperlipidemia. Journal of Lipid Research 34 295–308.[Abstract]
Fialova L, Mikulikova L, Malbohan I, Benesova O, Stipek S, Zima T & Zwinger A 2002 Antibodies against oxidized low density lipoproteins in pregnant women. Physiological Research 51 355–361.[Web of Science][Medline]
Forest J, Garrido-Russo M, Lemay A, Carrier R & Dubé JL 1983 Reference values for the oral glucose tolerance test at each trimester of pregnancy. American Journal of Clinical Pathology 80 828–831.[Web of Science][Medline]
Forest J, Masse JC & Garrido-Russo M 1994 Glucose tolerance test during pregnancy: the significance of one abnormal value. Clinical Biochemistry 24 299–304.
Gafvels ME, Coukos G, Sayegh R, Coutifaris C, Strickland DK & Strauss JF III 1992 Regulated expression of the trophoblast alpha 2-macroglobulin receptor/low density lipoprotein receptor-related protein. Differentiation and cAMP modulate protein and mRNA levels. Journal of Biological Chemistry 267 21230–21234.
Gitto E, Reiter RJ, Karbownik M, Tan DX, Gitto P, Barberi S & Barberi I 2002 Causes of oxidative stress in the pre- and perinatal period. Biology of the Neonate 81 146–157.[CrossRef][Web of Science][Medline]
Gratacos E, Casals E, Deulofeu R, Cararach V, Alonso PL & Fortuny A 1998 Lipid peroxide and vitamin E patterns in pregnant women with different types of hypertension in pregnancy. American Journal of Obstetrics and Gynecology 178 1072–1076.[CrossRef][Web of Science][Medline]
Greenberg AS & Obin MS 2006 Obesity and the role of adipose tissue in inflammation and metabolism. American Journal of Clinical Nutrition 83 461S–465S.
Grundy SM 2004 Obesity, metabolic syndrome, and cardiovascular disease. Journal of Clinical Endocrinology and Metabolism 89 2595–2600.
Gwynne JT & Mahaffee DD 1989 Rat adrenal uptake and metabolism of high density lipoprotein cholesteryl ester. Journal of Biological Chemistry 264 8141–8150.
Halvorsen B, Staff AC, Henriksen T, Sawamura T & Ranheim T 2001 8-iso-prostaglandin F(2) increases expression of LOX-1 in JAR cells. Hypertension 37 1184–1190.
Havel PJUpdate on adipocyte hormones: regulation of energy balance and carbohydrate/lipid metabolismDiabetes 53 (Supplement_1) 2004 S143–S151.
Heitritter SM, Solomon CG, Mitchell GF, Skali-Ounis N & Seely EW 2005 Subclinical inflammation and vascular dysfunction in women with previous gestational diabetes mellitus. Journal of Clinical Endocrinology and Metabolism 90 3983–3988.
Herrera E 2002 Lipid metabolism in pregnancy and its consequences in the fetus and newborn. Endocrine 19 43–55.[CrossRef][Web of Science][Medline]
Hofnagel O, Luechtenborg B, Eschert H, Weissen-Plenz G, Severs NJ & Robenek H 2006 Pravastatin inhibits expression of lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) in Watanabe heritable hyperlipidemic rabbits: a new pleiotropic effect of statins. Arteriosclerosis, Thrombosis, and Vascular Biology 26 604–610.
Honing ML, Morrison PJ, Banga JD, Stroes ES & Rabelink TJ 1998 Nitric oxide availability in diabetes mellitus. Diabetes/Metabolism Reviews 14 241–249.[CrossRef][Web of Science][Medline]
Kaaja R 1998 Insulin resistance syndrome in preeclampsia. Seminars in Reproductive Endocrinology 16 41–46.[Web of Science][Medline]
Kanne JP, Lalani TA & Fligner CL 2005 The placenta revisited: radiologic–pathologic correlation. Current Problems in Diagnostic Radiology 34 238–255.[CrossRef][Medline]
Kataoka H, Kume N, Miyamoto S, Minami M, Murase T, Sawamura T, Masaki T, Hashimoto N & Kita T 2000 Biosynthesis and post-translational processing of lectin-like oxidized low density lipoprotein receptor-1 (LOX-1). N-linked glycosylation affects cell-surface expression and ligand binding. Journal of Biological Chemistry 275 6573–6579.
King JC 2006 Maternal obesity, metabolism, and pregnancy outcomes. Annual Review of Nutrition 26 271–291.[CrossRef][Web of Science][Medline]
Kita T, Kume N, Minami M, Hayashida K, Murayama T, Sano H, Moriwaki H, Kataoka H, Nishi E, Horiuchi H, Arai H & Yokode M 2001 Role of oxidized LDL in atherosclerosis. Annals of the New York Academy of Sciences 947 199–205(discussion 205–196).[CrossRef][Web of Science][Medline]
Koukkou E, Watts GF & Lowy C 1996 Serum lipid, lipoprotein and apolipoprotein changes in gestational diabetes mellitus: a cross-sectional and prospective study. Journal of Clinical Pathology 49 634–637.
Kume N, Murase T, Moriwaki H, Aoyama T, Sawamura T, Masaki T & Kita T 1998 Inducible expression of lectin-like oxidized LDL receptor-1 in vascular endothelial cells. Circulation Research 83 322–327.
Kume N, Moriwaki H, Kataoka H, Minami M, Murase T, Sawamura T, Masaki T & Kita T 2000 Inducible expression of LOX-1, a novel receptor for oxidized LDL, in macrophages and vascular smooth muscle cells. Annals of the New York Academy of Sciences 902 323–327.[Web of Science][Medline]
Lafond J, Auger D, Fortier J & Brunette MG 1988 Parathyroid hormone receptor in human placental syncytiotrophoblast brush border and basal plasma membranes. Endocrinology 123 2834–2840.
Lafond J, Charest MC, Alain JF, Brissette L, Masse A, Robidoux J & Simoneau L 1999 Presence of CLA-1 and HDL binding sites on syncytiotrophoblast brush border and basal plasma membranes of human placenta. Placenta 20 583–590.[CrossRef][Medline]
Lee H, Park H, Kim YJ, Kim HJ, Ahn YM, Park B, Park JH & Lee BE 2005 Expression of lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) in human preeclamptic placenta: possible implications in the process of trophoblast apoptosis. Placenta 26 226–233.[CrossRef][Medline]
Li D & Mehta JL 2000 Antisense to LOX-1 inhibits oxidized LDL-mediated upregulation of monocyte chemoattractant protein-1 and monocyte adhesion to human coronary artery endothelial cells. Circulation 101 2889–2895.
Li L, Sawamura T & Renier G 2003 Glucose enhances endothelial LOX-1 expression: role for LOX-1 in glucose-induced human monocyte adhesion to endothelium. Diabetes 52 1843–1850.
Li L, Sawamura T & Renier G 2004 Glucose enhances human macrophage LOX-1 expression: role for LOX-1 in glucose-induced macrophage foam cell formation. Circulation Research 94 892–901.
Mehta JL, Chen J, Hermonat PL, Romeo F & Novelli G 2006 Lectin-like, oxidized low-density lipoprotein receptor-1 (LOX-1): a critical player in the development of atherosclerosis and related disorders. Cardiovascular Research 69 36–45.
Moriwaki H, Kume N, Sawamura T, Aoyama T, Hoshikawa H, Ochi H, Nishi E, Masaki T & Kita T 1998 Ligand specificity of LOX-1, a novel endothelial receptor for oxidized low density lipoprotein. Arteriosclerosis, Thrombosis, and Vascular Biology 18 1541–1547.
Nagase M, Hirose S, Sawamura T, Masaki T & Fujita T 1997 Enhanced expression of endothelial oxidized low-density lipoprotein receptor (LOX-1) in hypertensive rats. Biochemical and Biophysical Research Communications 237 496–498.[CrossRef][Web of Science][Medline]
Pavan L, Hermouet A, Tsatsaris V, Therond P, Sawamura T, Evain-Brion D & Fournier T 2004 Lipids from oxidized low-density lipoprotein modulate human trophoblast invasion: involvement of nuclear liver X receptors. Endocrinology 145 4583–4591.
Rajman I, Eacho PI, Chowienczyk PJ & Ritter JM 1999 LDL particle size: an important drug target? British Journal of Clinical Pharmacology 48 125–133.[CrossRef][Web of Science][Medline]
Ramsay JE, Ferrell WR, Crawford L, Wallace AM, Greer IA & Sattar N 2002 Maternal obesity is associated with dysregulation of metabolic, vascular, and inflammatory pathways. Journal of Clinical Endocrinology and Metabolism 87 4231–4237.
Robidoux J, Simoneau L, St-Pierre S, Ech-Chadli H & Lafond J 1998 Human syncytiotrophoblast NPY receptors are located on BBM and activate PLC-to-PKC axis. American Journal of Physiology 274 E502–E509.[Web of Science][Medline]
Rosen P, Nawroth PP, King G, Moller W, Tritschler HJ & Packer L 2001 The role of oxidative stress in the onset and progression of diabetes and its complications: a summary of a Congress Series sponsored by UNESCO-MCBN, the American Diabetes Association and the German Diabetes Society. Diabetes/Metabolism Research and Reviews 17 189–212.[CrossRef]
Ross R 1999 Atherosclerosis – an inflammatory disease. New England Journal of Medicine 340 115–126.
Sacks GP, Studena K, Sargent K & Redman CW 1998 Normal pregnancy and preeclampsia both produce inflammatory changes in peripheral blood leukocytes akin to those of sepsis. American Journal of Obstetrics and Gynecology 179 80–86.[CrossRef][Web of Science][Medline]
Sakurai K & Sawamura T 2003 Stress and vascular responses: endothelial dysfunction via lectin-like oxidized low-density lipoprotein receptor-1: close relationships with oxidative stress. Journal of Pharmacological Sciences 91 182–186.[CrossRef][Web of Science][Medline]
Sanchez-Vera I, Bonet B, Viana M, Quintanar A, Martin MD, Blanco P, Donnay S & Albi M 2007 Changes in plasma lipids and increased low-density lipoprotein susceptibility to oxidation in pregnancies complicated by gestational diabetes: consequences of obesity. Metabolism 56 1527–1533.[CrossRef][Web of Science][Medline]
Sawamura T, Kume N, Aoyama T, Moriwaki H, Hoshikawa H, Aiba Y, Tanaka T, Miwa S, Katsura Y, Kita T & Masaki T 1997 An endothelial receptor for oxidized low-density lipoprotein. Nature 386 73–77.[CrossRef][Web of Science][Medline]
Serdar Z, Gur E, Develioglu O, Colakogullari M & Dirican M 2002 Placental and decidual lipid peroxidation and antioxidant defenses in preeclampsia. Lipid peroxidation in preeclampsia. Pathophysiology 9 21.[CrossRef][Medline]
Spranger J, Kroke A, Mohlig M, Hoffmann K, Bergmann MM, Ristow M, Boeing H & Pfeiffer AF 2003 Inflammatory cytokines and the risk to develop type 2 diabetes: results of the prospective population-based European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam Study. Diabetes 52 812–817.
Steinberg D 1997 Lewis A. Conner Memorial Lecture. Oxidative modification of LDL and atherogenesis. Circulation 95 1062–1071.
Stevens MJ 2005 Oxidative-nitrosative stress as a contributing factor to cardiovascular disease in subjects with diabetes. Current Vascular Pharmacology 3 253–266.[CrossRef][Medline]
Tames FJ, Mackness MI, Arrol S, Laing I & Durrington PN 1992 Non-enzymatic glycation of apolipoprotein B in the sera of diabetic and non-diabetic subjects. Atherosclerosis 93 237–244.[CrossRef][Web of Science][Medline]
Taskinen MR 1990 Hyperlipidaemia in diabetes. Baillière's Clinical Endocrinology and Metabolism 4 743–775.[CrossRef][Web of Science][Medline]
Toescu V, Nuttall SL, Martin U, Kendall MJ & Dunne F 2002 Oxidative stress and normal pregnancy. Clinical Endocrinology 57 609–613.[CrossRef][Medline]
Walsh SW & Wang Y 1993 Secretion of lipid peroxides by the human placenta. American Journal of Obstetrics and Gynecology 169 1462–1466.[Web of Science][Medline]
Warth MR, Arky RA & Knopp RH 1975 Lipid metabolism in pregnancy. II. Altered lipid composition in intermediage, very low, low and high-density lipoprotein fractions. Journal of Clinical Endocrinology and Metabolism 41 649–655.
Wisdom SJ, Wilson R, McKillop JH & Walker JJ 1991 Antioxidant systems in normal pregnancy and in pregnancy-induced hypertension. American Journal of Obstetrics and Gynecology 165 1701–1704.[Web of Science][Medline]
Wittmaack FM, Gafvels ME, Bronner M, Matsuo H, McCrae KR, Tomaszewski JE, Robinson SL, Strickland DK & Strauss JF III 1995 Localization and regulation of the human very low density lipoprotein/apolipoprotein-E receptor: trophoblast expression predicts a role for the receptor in placental lipid transport. Endocrinology 136 340–348.[Abstract]
Witztum JL & Horkko S 1997 The role of oxidized LDL in atherogenesis: immunological response and anti-phospholipid antibodies. Annals of the New York Academy of Sciences 811 88–96(discussion 96–89).[Web of Science][Medline]
Xiang AH, Peters RK, Trigo E, Kjos SL, Lee WP & Buchanan TA 1999 Multiple metabolic defects during late pregnancy in women at high risk for type 2 diabetes. Diabetes 48 848–854.[Abstract]
Yoshida H, Kondratenko N, Green S, Steinberg D & Quehenberger O 1998 Identification of the lectin-like receptor for oxidized low-density lipoprotein in human macrophages and its potential role as a scavenger receptor. Biochemical Journal 334 9–13.[Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
