| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
RESEARCH |
Department of Obstetrics and Gynaecology, Erlangen University Hospital, Universitaetsstrasse 21–23, 91054 Erlangen, Germany and1 Infertility Clinic, Nuernberger Strasse 35, 91052 Erlangen, Germany
Correspondence should be addressed to H Binder; Email: helge.binder{at}uk-erlangen.de
 |
Abstract |
|---|
 Top Abstract IntroductionResultsDiscussionMaterials and MethodsAcknowledgementsReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgementsReferences |
|---|
The condition of OHSS is potentially life threatening and mostly occurs during controlled ovarian stimulation. This syndrome is characterized by enlarged and polycystic ovaries, ascites and generalized oedema, in addition to other symptoms (Delvigne & Rozenberg 2003, Binder et al. 2004). OHSS almost always occurs along with human chorionic gonadotrophin (hCG) therapy, used for the induction of ovulation, compounded by embryonic hCG in case of pregnancy. An excessive ovarian reaction to hCG leads to the development of more or less marked symptoms. Despite multiple published analyses, the aetiology of OHSS is not yet fully understood and several genes may be involved. The follicle-stimulating hormone receptor gene (FSHR gene; Fig. 1) appears to be one candidate for the very rare condition of spontaneous OHSS (Smits et al. 2003). One specific gene variation in the FSHR gene, which leads to a non-synonymous amino acid exchange at Asp567Asn, has been found to result in a conformation change of the serpentine region (Smits et al. 2003). This FSHR mutation appeared to cause a reduction in ligand specificity that allowed activation of the mutated receptor by hCG. In other patients with spontaneous OHSS, new FSHR conformation-altering mutations were found at codon 449, resulting in a substitution of threonine for either isoleucine or alanine (Thr449Ile and Thr449Ala; Fig. 1; Vasseur et al. 2003, Montanelli et al. 2004).
|
Other FSHR gene variations causing more or less pronounced loss of FSHR function and affecting fertility have been published, such as the very common polymorphism Asn680Ser being in linkage disequilibrium with Thr307Ala (Al-Hendy et al. 2000, d'Alva et al. 2005) and rare mutations like Ile160Thr and Ala189Val (Fig. 1). Greb et al. (2005) investigated the influence of the FSHR Asn680Ser genotype on menstrual cycle dynamics in women and found differences in hormonal levels during the luteal phase. Aittomaki et al. (1995) and Sipila & Aula (2002) noted that all patients out of six families with autosomal recessive premature ovarian failure in Finland had an Ala189Val mutation in the FSHR gene. All these families were living in a small area with a presumably high rate of inbreeding. Beau et al. (1998) diagnosed other FSHR gene variations, Ile160Thr in combination with Arg573Cys, both heterozygous causing a loss of FSHR function in a 30-year-old Armenian woman who had already developed secondary amenorrhoea at the age of 16.
There are data showing that the outcome of controlled ovarian hyperstimulation may depend on interacting genetic and non-genetic factors that are related to hormone receptor activation. In mice the ovulation rate has been associated with increased cytochrome P450 19A1 (CYP19A1) aromatase gene activity and oestrogen production (de Castro et al. 2005b). In addition, there is evidence that the reference SNP ID 10046 (rs10046) single nucleotide polymorphism (SNP) locus of the aromatase (CYP19A1) gene in the 3' UTR is associated with altered pituitary suppression in premenopausal women (de Castro et al. 2005a). This may suggest the hypothesis that gene variations activating the CYP19A1 gene may also be associated with OHSS.
The rationale behind this investigation was the assumption that activating SNPs and SNPs that could compromise FSHR function may show different distribution patterns in ART patients with or without OHSS compared with patients with normal fecundity and with HL. We therefore assessed the distribution of the following FSHR gene variations: Asn680Ser, Ile160Thr, Ala189Val, Thr449Ile and CYP19A1 rs10046 polymorphism in ART patients with or without OHSS, non-ART patients, and additionally sequenced exon 10 of FSHR in two patients with the rare condition of HL.
|
Results |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgementsReferences |
|---|
In the control group 73 patients out of the 88 (82.9%) had at least one recorded pregnancy or were pregnant when blood samples were taken.
Most OHSS patients had the following symptoms, in decreasing order of frequency (ICD codes in brackets): ascites (R18), pain (R10.1), increase in abdominal girth (R19), temperature >37 °C (R50.9), abdominal tension (R19.8), dyspnoea (R06.88), pleural effusions, nausea (R11), emesis (R11), generalized oedema (R60.1), diarrhoea (K58.0), urinary tract infection (N39.0), circulatory collapse (R55) and thrombosis (I80.2, I82.8; Fig. 2).
|
|
|
The CYP19A1 rs10046 genotype frequencies for cytosine/cytosine (C/C), cytosine/thymidine (C/T) and T/T were 22.0, 63.7 and 14.3% for the OHSS patients; 23.5, 57.6 and 18.8%, and 19.6, 59.8 and 20.6% for the control groups (‘ART/no OHSS’ and ‘no ART’) respectively. There were no significant differences between the groups (Table 1).
In the ‘OHSS’ group, 15.4% out of the 91 women were found to be homozygous for the wild-type Asn680, while 51.6% were heterozygous (Asn680/Ser680) and 33.0% were homozygous for mutant Ser680/Ser680. The ‘ART/no OHSS’ control group revealed a distribution of 17.4 (wild-type), 46.5 (heterozygote) and 36.1% (homozygote mutant). PCR amplification was not successful in two samples. Among the 97 patients in the ‘no ART’ control group, 24.8% were wild-type for Asn680, 54.6% heterozygote and 20.6% homozygote mutant. No significant differences were found between the ‘OHSS’ and ‘ART/no OHSS’ groups, but there was a more than 40% lower frequency of Ser680/Ser680 polymorphism in the ‘no ART’ group (Table 1). In contrast, wild-type Asn680/Asn680 was markedly less frequent in the ‘ART/no OHSS’ and ‘OHSS’ groups (minus 30 and 38% respectively). Performing the Pearson 
2-test with all three groups together, there was no significant difference.
The distribution of the SNP Cyp19A1 rs10046 was found to be predominantly heterozygous (57.6–63.7%). Of all patients, 19.6–23.5% were homozygous for C/C (wild-type) and 14.3–20.6% homozygous for T/T. The frequency of C/T was higher in patients with OHSS (63.7%) and lower for the homozygous T/T polymorphism (14.3%), although not significant.
Unexpectedly, the frequency of Ile160Thr (heterozygous and homozygous mutated) in patients with ART with and without OHSS was 6.7 and 6.1% respectively. Five patients in the ‘OHSS’ as well as in the ‘ART/no OHSS’ groups were heterozygous and one homozygous for Thr160/Thr160 (‘OHSS’ group), whereas patients with normal fecundity were all Ile160/Ile160 (wild-type; Table 1).
In the present study, the two patients with spontaneous HL had showed no activating FSHR mutations in exon 10 (Thr449Ile/Ala, Ile545Thr or Asp567Asn/Gly). Heterozygosity could be demonstrated in one patient for Ile160Thr, whereas both presented the homozygous polymorphism Ser680/Ser680 (Table 2).
By combining groups, where applicable, we noted a significant difference between patients with normal fecundity (‘no ART’) and patients treated for sterility (OHSS and ‘ART/no OHSS’ groups combined), with P=0.035 (Table 3). We could show a difference by comparing ART patients and patients with normal fecundity, although not significant. No significant differences were found among IVF patients with or without OHSS.
|
Further subgroup analysis revealed significant differences of the FSHR Ile160Thr distribution in the ‘no ART’ group compared with the ‘OHSS’ group, the ‘ART/no OHSS’ group, the ‘OHSS grades II–III’ subgroup or ART group. P values were 0.034, 0.019, 0.026 and 0.039 respectively. No significances or trends were found when comparing the other groups (Table 4).
|
|
Discussion |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgementsReferences |
|---|
Although the conditions differ with regard to the time of their occurrence, spontaneous and iatrogenic OHSS share similar pathophysiological sequences, with massive recruitment and growth of ovarian follicles due to non-physiological luteinization. In the iatrogenic form, the pathologic cascade leading to massive fluid shifts is caused by ovarian stimulation with exogenous FSH (Delbaere et al. 2005). In the study by Daelemans et al. (2004), the data show a significantly higher frequency of the FSHR Ser680/Ser680 polymorphism in comparison with the IVF control group, in contrast to the present findings. However, the data presented here confirm a significantly lower Ser680/Ser680 combined with a higher Asn680/Asn680 frequency in Caucasian control individuals without ART.
To date, five different activating FSHR gene variations have been reported in patients with spontaneous OHSS (Delbaere et al. 2006). In addition to Asp567Asn, Asp567Gly, Thr449Ile and Thr449Ala, De Leener et al. (2006) reported another novel FSHR gene variation, Ile545Thr, in a patient with spontaneous OHSS, previously described by Chae et al. (2001). In the present study, the patients with spontaneous HL had no activating FSHR mutations (Thr449Ile/Ala, Ile545Thr or Asp567Asn/Gly). Interestingly, one patient showed a heterozygous Ile160Thr and both had a homozygous Ser680/Ser680, the latter gene variations with an assumed minimal loss of FSHR function.
Fifty-five cases of HL have been published to date (PubMed search). The aetiology of HL is still unclear but the main aetiological factor for the development of HL could be some intrinsic sensitivity to gonadotrophins causing marked hypertrophy followed by luteinization of the theca-interna layer, concomitantly with elevated vascular endothelial growth factor (VEGF) levels and other mediators (Haimov-Kochman et al. 2004, Suzuki 2004). The pathological changes that occur in the ovary affected by HL seem to be similar to those seen with OHSS, a condition that typically occurs in the first trimester (Langer & Coleman 2007). Historically, HL was diagnosed typically in the third trimester (54%) during a caesarean section or the puerperium (16%) with bilateral enlargement of the ovaries (Foulk et al. 1997). Only 16% developed HL in the first trimester (Suzuki 2004). Both cases here developed HL around 11th week of gestation with normalization of ovarian size around 21st week of gestation. One may assume different pathophysiological pathways for ‘early’ HL in contrast to ‘late’ HL. Ascites in patients suffering from HL is mostly a rare phenomenon (4%; Foulk et al. 1997). None of the reported cases here presented ascites. HL has been well described as a complication of pregnancy in which there are elevated serum β-hCG levels such as hydatidiform mole and choriocarcinoma (Langer & Coleman 2007). However, HL may rarely occur without elevated β-hCG levels, as described here, too. According to Foulk et al. (1997) and Suzuki (2004), there seems to be an association with maternal hirsutism (14–25%) as was the case with patient #4200. Affected women with gestational hyperandrogenism and HL may have a variety of symptoms including hirsutism (at times requiring shaving), acne, temporal balding, even clitoromegaly and deepening of the voice (Angioni et al. 2007). There are some reports of complications due to rupture of ovarian cysts with subsequent development of an acute abdomen, in agreement with our second case (Morken et al. 2007). No genetic causes are reported to date; although the familial pattern in case 2 would imply such a background.
FSHR Thr449Ile gene variation seems to be a rare mutation described in spontaneous OHSS only once (Vasseur et al. 2003). This gene variation could be detected neither in our patients with iatrogenic OHSS nor in those with HL.
In addition, we could demonstrate the presence of a heterozygous CYP19A1 rs10046 polymorphism in one patient suffering from rather this rare condition. Since CYP19A1 is a polymorphism with a high frequency in the normal population, its implication in this condition remains uncertain.
Greb et al. (2005) investigated the influence of the FSHR Asn680Ser genotype on menstrual cycle dynamics in women. Female menstrual cycle is tightly controlled by pituitary gonadotrophin secretion, which is regulated by ovarian hormones. The secretion of ovarian hormones reflects recruitment of a cohort of antral-stage follicles by elevated FSH concentrations prior to menstrual bleeding. The fate of most of these recruited follicles is atresia. Only one or two follicles selectively become in the end tertiary follicles, with FSH-induced growth and differentiation of granulosa cells. These cells regulate further oocyte maturation (Greb et al. 2005). Even a minuscule loss of FSHR function due to inactivating gene variants could influence fecundity. Both FSHR polymorphisms investigated here, Ile160Thr and Asn680Ser, may have the potential to do so. Greb et al. (2005) could demonstrate for the first time that patients with the Ser680/Ser680 genotype are more resistant to FSH action and thus require a stronger stimulus for the same biological response. In a follow-up study Behre et al. (2005) were able to show convincingly that patients with the homozygous FSHR Ser680/Ser680 polymorphism required higher FSH dosages in order to show the same oestradiol response during controlled ovarian stimulation. In our study control patients with normal fecundity had a lower genotype frequency of Ser680/Ser680 in accordance with Daelemans et al. (2004), emphasizing the data of Behre et al. (2005) and Greb et al. (2005). No data concerning the influence of Ile160Thr gene variant on the length of menstrual cycle exists so far.
An altered ovarian reaction may not only be explained by a possible conformational change in the FSHR but also by a subsequently reduced activation of the FSHR-dependent CYP19A1. There is strong evidence that CYP19A1 is involved in the recruitment and selection of ovarian follicles (Bao et al. 1997). As there is a commonly observed association between elevated oestrogen levels and the severity of OHSS, oestradiol levels could be used as a predictive marker (Rizk 2006). Since a similar genotype distribution of the CYP19A1 rs10046 locus was found in patients with and without ART, there appears to be no association between the CYP19A1 rs10046 marker and iatrogenic OHSS. However, more than 200 other gene variations of the CYP19A1 gene are currently known (de Castro et al. 2005a).
The FSHR gene variation Ala189Val is known to be associated with ovarian dysgenesis in his homozygous form (Aittomaki et al. 1995, Sipila & Aula 2002). However, there was no difference among the groups for the gene variation Ala189Val in our analysis. In contrast, the heterozygous form Ile160Thr is presumed to induce a loss of FSHR function and seems to be more frequent. Beau et al. (1998) found a compound mutation of heterozygous Ile160Thr and Arg573Cys resulting in a premature ovarian failure (POF). We found no Ile160Thr mutation in the group of patients with normal fecundity, which implies that not only the compound mutations Ile160Thr and Arg573Cys exert an FSHR functional change but also heterozygous Ile160Thr, although far less pronounced. In contrast to spontaneous OHSS, iatrogenic OHSS seems to be multifactorial and not caused by gene variations altering FSHR function. This assumption is sustained by another recent publication in which sequencing of both the FSH and LH receptors of patients with iatrogenic OHSS and controls revealed no differences (Kerkelä et al. 2007).
It seems quite tempting to compare clinical data and symptoms compromised by a wide variety of biases in different studies conducted in different countries. In the patients included in the present study, 46.5% (40/86) were classified as having severe OHSS (grade III). All had received hormonal stimulation for IVF, with or without intracytoplasmic sperm injection (ICSI). In contrast to these findings, Abramov et al. (1998a) reported that 7.2% of patients had OHSS grades V and VI. This marked difference can in part be explained by the different classification using six grades commonly referred to in Israel (Rabau et al. 1967).
In agreement with Qasim et al. (1997), Mathur et al. (2000) and Wang et al. (2002), we distinguish between early and late-onset OHSS. Interestingly, Qasim et al. (1997) found that 71.4% of patients with severe OHSS developed late-onset OHSS, in contrast to the findings presented in this study. At the Erlangen University Hospital, 61 of the 86 of patients (70.9%) with OHSS developed early onset OHSS.
With regard to pregnancy rates, Cunha-Filho et al. (2003) reported a pregnancy rate of 52% in women with severe OHSS – slightly higher than the pregnancy rate of 45.3% in the present study, whereas, again, Abramov et al. (1998b) reported a much higher pregnancy rate of 73% in his OHSS patients (grades V and VI).
In conclusion, the FSHR gene and other gene variations may play a role in modulating receptor sensitivity and intracellular second messenger cascades to exogenous hCG and other gonadotrophins. Higher frequencies of wild-type FSHR Asn680Ser and Ile160Thr appear to improve fecundity, but cannot be used to predict the severity of OHSS, given that the number of patients investigated here was rather small. CYP19A1 rs10046 locus seems to have no impact on OHSS or sterility. No polymorphisms could be demonstrated that may lead to the condition of HL.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgementsReferences |
|---|
Two control groups were established. Eighty-eight control patients (the ‘ART/no OHSS’ group) who had been treated in the Infertility Clinic, Erlangen, Germany with IVF or ICSI without developing OHSS, were interviewed and consented to undergo an additional blood sample. Ninety-seven parturients admitted to our delivery room (the ‘no ART’ group), with apparently normal fecundity, who had at least one normal pregnancy and no fertility treatment in their personal history provided written consent to undergo blood sampling. All patients in the control groups except two Asian women in the ‘no ART’ group were of Caucasian origin. In addition two patients with HL were analysed simultaneously.
Exclusion criteria for the control patients were: status post-OHSS in a previous stimulation treatment, a large number of follicles (>15–20) before aspiration, high oestrogen levels (>4500 pg/ml) before aspiration, known genomic or germline mutations and, for the second control group, any kind of fertility treatment.
To define OHSS, WHO criteria were used as published elsewhere (Delvigne & Rozenberg 2003, Binder et al. 2004). We distinguished between mild (grade I), moderate (grade II) and severe (grade III) OHSS. Statistical analysis was carried out using the Statistical Program for the Social Sciences version 14.0 for Windows. The statistical procedures used for data evaluation were cross-tables combined with the 2-test (Pearson). For reference purposes, the nomenclature used to describe FSHR gene variations is in accordance with the National Centre for Biotechnology Information (NCBI) protein sequence: P23945
[GenBank]
.
DNA preparation
Genomic DNA from 8 ml blood was extracted using a genomic DNA purification kit (Puregene, Gentra Systems Inc., Minneapolis, MN, USA), with modifications. Briefly, after initial centrifugation, the white blood cell layer was removed and added to red blood cells (RBC) lysis buffer (pH 7.3) containing 0.15 M NH4Cl, 0.01 M K2CO3 and 0.1 mM Na-EDTA. After 10 min of incubation, the cells were centrifuged at 2000 g and vortexed with a 3 ml cell lysis buffer containing 20 mM Tris, 15 mM Na-EDTA and 1% SDS and treated with RNase A and proteinase K. The proteins were precipitated with 1 ml protein precipitation solution (Puregene) and the DNA precipitated by the addition of isopropanol, washed with 70% ethanol, dried, solubilized with a Tris-EDTA buffer (pH 7.5) quantitated using a spectrophotometer and stored at –80 °C. Using this methodology, an average of 70–100 µg DNA per patient was obtained.
Genotyping with real-time PCR
TaqMan assays for analysis of the FSHR SNP gene variations Asn680Ser (rs6166), Ile160Thr, Ala189Val (in accordance with NCBI protein sequence P23945
[GenBank]
) and CYP19 rs10046 were purchased from Applied Biosystems Applera Deutschland, Ltd (Darmstadt, Germany). The assay for the FSHR SNP Thr449Ile was designed using the primers: forward, 5' GGGCAGGCTGTGATGCT and reverse, 5' GGTGATAGCTGTCAGAGTGTAGACT; and the allelic-specific primers: 5' AAAGACAGTGAAAAAG (VIC) and 5' AAAGACAATGAAAAAG (FAM). All analyses were performed with the real-time PCR machines ABI7000 and 7300 in accordance with the manufacturer's protocol. Quality control testing of the FSHR Thr449Ile SNP was carried out by Applied Biosystems. Quality control was established in the laboratory using routine tests of DNA from the control group with different SNP assays for homozygosity and heterozygosity. The FSHR gene variations Asp567Asn and Asp567Gly demonstrated non-specific primer binding and thus could not be evaluated with real-time PCR.
Case reports of two out-patients with HL
Case 1
A 37-year-old German woman (#4477), gravida 1, para 0 was referred to our hospital by her attending obstetrician for further examination at 10+6 weeks' gestation. She had no abdominal symptoms. Vaginal examination revealed a normal cervix, a uterus enlarged to 11 weeks of gestation and non-tender cystic masses palpable in the lower abdomen. Ultrasound examination showed a normal developing foetus, bilaterally enlarged ovaries with multiple cysts (right 5.3x3.5x5.7, left 5.3x2.8x4.6 cm). No fluid in the cul-de-sac or signs of a hydatidiform mole was detectable. Laboratory results (haemoglobin, coagulation profile, thyroid-stimulating hormone (TSH) and other serum parameters) were within the normal range. β-hCG was 66.000 mlU/ml. The patient consulted her attending doctor again one week later (11+5 weeks) with virtually unchanged ovaries. hCG was not determined. At the 17+6 weeks of gestation, the attending obstetrician and gynaecologist reported scaled-down ovaries with the maximum diameter of 3 cm. Further pregnancy was without complications. The patient delivered a healthy male baby weighting 3419 g and measuring 53 cm at 42+5 weeks of gestation by caesarean section, due to bradytocia.
In a further interview the patient reported having no problems getting pregnant. After 18 years of continuously taking oral contraception, she became pregnant as soon as she finished contraception. In contrast to this, her sister experienced a 6-year-period sterility with acyclicity and sterility treatment. Her sister did not report of enlarged ovaries during early pregnancy nor did the patients' mother.
Case 2
The second patient (#4200), ethnically a Persian, is a 35-year-old physician who lives in Vienna, Austria. She contacted our hospital via internet and reported her problems during her pregnancies in 2003 and 2006. She had a personal history of oligomenorrhoea, acne, PCO-like ovaries and showed discrete signs of hirsutism. Her body mass index, before and after pregnancies, was around 19 kg/m2. Hormonal values were within the normal range for testosterone, prolactin, dehydroepiandrosterone sulfate, TSH and thyroxin. Sex hormone-binding globulin was abased and androstenedione slightly elevated. Due to her skin problems, oral contraceptives with cyproteron acetate were applied for 10 years.
In her first pregnancy in 2003, she complained about conspicuously increasing abdominal girth and hyperemesis. Gynaecological and ultrasound examinations in the 11th week of gestation revealed grossly enlarged ovaries with diameters of 12–14 cm and palpable masses in the lower abdomen. Due to the rupture of a cyst (right ovary) and sharp onset of pain she was hospitalized for 5 days. Gradually thereafter, severity of symptoms decreased and after 21st to 22nd week, the size of ovaries was within the normal range. In the 38+0 week of gestation an emergency section had to be performed due to abruption of placenta. Nevertheless, she delivered a healthy girl weighing 3150 g and measuring 50 cm.
In her second pregnancy in 2005, she experienced the same symptoms in early pregnancy. In the 11+1 week of gestation, massively enlarged ovaries (14–15 cm) with multiple luteal cysts up to 4 cm were diagnosed. As in the first pregnancy she complained of emesis and discomfort in the lower abdominal region. Only discrete amounts of ascites could be demonstrated. β-hCG was 108.000 mU/ml; TSH, blood count and all other laboratory parameters were within the normal range. Again problems resolved around the 22nd week of gestation. Further, pregnancy was uneventful and in the 37+1 week a caesarean section was performed electively. She delivered a healthy girl weighing 2730 g and measuring 46 cm.
Additionally, the patient reported a familial pattern since her mother experienced the same problems when pregnant with the patient and her elder brother. In 1973 an emergency ovarian wedge resection was necessary in the first pregnancy.
DNA sequencing
In order to find SNPs already demonstrated in patients with spontaneous OHSS or to demonstrate even new gene variants, exon 10 of FSHR (1243 bp, X91747
[GenBank]
) of patients #4200 and #4477 was amplified from genomic DNA using standard primer and purified. The amplified DNA was then sequenced using different exon 10 primer and ABI Prism BigDye terminator v 1.1 (Applied Biosystems) and analysed on an ABI3100 Avant sequencer (University of Regensburg, Institute for Human Genetics, Germany).
|
Acknowledgements |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgementsReferences |
|---|
Received 16 June 2007
First decision 2 August 2007
Accepted 10 October 2007
|
References |
|---|
|
TopAbstractIntroductionResultsDiscussionMaterials and MethodsAcknowledgementsReferences |
|---|
Abramov Y, Elchalal U & Schenker JG 1998a Obstetric outcome of in vitro fertilized pregnancies complicated by severe ovarian hyperstimulation syndrome: a multicenter study. Fertility and Sterility 70 1070–1076.[CrossRef][Web of Science][Medline]
Abramov Y, Elchalal U & Schenker JG 1998b Febrile morbidity in severe and critical ovarian hyperstimulation syndrome: a multicentre study. Human Reproduction 13 3128–3131.
Aittomaki K, Lucena JLD, Pakarinen P, Sistonen P, Tapanainen J, Gromoll J, Kaskikari R, Sankila E-M, Lehvaslaiho H, Engel AR et al. 1995 Mutation in the follicle-stimulating hormone receptor gene causes hereditary hypergonadotropic ovarian failure. Cell 82 959–968.[CrossRef][Web of Science][Medline]
Angioni S, Portoghese E, Milano F, Melis GB & Fulghesu AM 2007 Hirsutism and hyperandrogenism associated with hyperreactio luteinalis in a singleton pregnancy: a case report. Gynecological Endocrinology 23 248–251.[CrossRef][Web of Science][Medline]
Bao B, Garverick HA, Smith GW, Smith MF, Salfen BE & Youngquist RS 1997 Changes in messenger ribonucleic acid encoding luteinizing hormone receptor, cytochrome P450-side chain cleavage, and aromatase are associated with recruitment and selection of bovine ovarian follicles. Biology of Reproduction 56 1158–1168.[Abstract]
Beau I, Touraine P, Meduri G, Gougeon A, Desroches A, Matuchansky C, Milgrom E, Kuttenn F & Misrahi M 1998 A novel phenotype related to partial loss of function mutations of the follicle stimulating hormone receptor. Journal of Clinical Investigation 102 1352–1359.[Web of Science][Medline]
Behre HM, Greb RR, Mempel A, Sonntag B, Kiesel L, Kaltwasser P, Seliger E, Ropke F, Gromoll J, Nieschlag E et al. 2005 Significance of a common single nucleotide polymorphism in exon 10 of the follicle-stimulating hormone (FSH) receptor gene for the ovarian response to FSH: a pharmacogenetic approach to controlled ovarian hyperstimulation. Pharmacogenetics and Genomics 15 451–456.[Web of Science]
Binder H, Cupisti S, Dittrich R, Einhaus F, Krieg J, Müller A, Strauss R & Beckmann MW 2004 Ovarielles Überstimulationssyndrom – update. Geburtshilfe und Frauenheilkunde 64 R53–R76.[CrossRef]
Butler PA 2003 Assisted reproduction in developing countries: facing up to the issues (special issue). World Health Organization Newsletter: Progress in Reproductive Health Research 63 1–2 (www.who.int/reproductive-health/hrp/progress/63/63.pdf).
de Castro F, Moron FJ, Montoro L, Galan JJ, Real LM & Ruiz A 2005a Re: polymorphisms associated with circulating sex hormone levels in postmenopausal women. Journal of National Cancer Institute 97 152–153.
de Castro F, Moron FJ, Montoro L & Real LM 2005b Pharmacogenetics of controlled ovarian hyperstimulation. Pharmacogenomics 6 629–637.[CrossRef][Web of Science][Medline]
Chae HD, Park EJ, Kim SH, Kim CH, Kang BM & Chang YS 2001 Ovarian hyperstimulation syndrome complicating a spontaneous singleton pregnancy: a case report. Journal of Assisted Reproduction and Genetics 18 120–123.[CrossRef][Web of Science][Medline]
Cunha-Filho JS, Samama M, Fanchin R, Righini C, Kadoch IJ, Frydman R & Olivennes F 2003 Clinical and laboratory evaluation of hospitalized patients with severe ovarian hyperstimulation syndrome. Reproductive Biomedicine Online 6 448–451.[Medline]
Daelemans C, Smits G, de Maertelaer V, Costagliola S, Englert Y, Vassart G & Delbaere A 2004 Prediction of severity of symptoms in iatrogenic ovarian hyperstimulation syndrome by follicle-stimulating hormone receptor Ser680Asn polymorphism. Journal of Clinical Endocrinology and Metabolism 89 6310–6315.
d'Alva CB, Serafini P, Motta E, Kohek MB, Latronico AC & Mendonca BB 2005 Absence of follicle-stimulating hormone receptor activating mutations in women with iatrogenic ovarian hyperstimulation syndrome. Fertility and Sterility 83 1695–1699.[CrossRef][Web of Science][Medline]
Delbaere A, Smits G, De Leener A, Costagliola S & Vassart G 2005 Understanding ovarian hyperstimulation syndrome. Endocrine 26 285–290.[CrossRef][Web of Science][Medline]
Delbaere A, Smits G, Vassart G & Costagliola S 2006 Genetic predictors of ovarian hyperstimulation syndrome in women undergoing in vitro fertilization. Nature Clinical Practice. Endocrinology and Metabolism 2 590–591.
Delvigne A & Rozenberg S 2003 Review of clinical course and treatment of ovarian hyperstimulation syndrome (OHSS). Human Reproduction Update 9 77–96.
Foulk RA, Martin MC, Jerkins GL & Laros RK 1997 Hyperreactio luteinalis differentiated from severe ovarian hyperstimulation syndrome in a spontaneously conceived pregnancy. American Journal of Obstetrics and Gynecology 176 1300–1302.[CrossRef][Web of Science][Medline]
Greb RR, Grieshaber K, Gromoll J, Sonntag B, Nieschlag E, Kiesel L & Simoni M 2005 A common single nucleotide polymorphism in exon 10 of the human follicle stimulating hormone receptor is a major determinant of length and hormonal dynamics of the menstrual cycle. Journal of Clinical Endocrinology and Metabolism 90 4866–4872.
Gromoll J, Ried T, Holtgreve-Grez H, Nieschlag E & Gudermann T 1994 Localization of the human FSH receptor to chromosome 2p21 using a genomic probe comprising exon 10. Journal of Molecular Endocrinology 12 265–271.
Haimov-Kochman R, Yanai N, Yagel S, Amsalem H, Lavy Y & Hurwitz A 2004 Spontaneous ovarian hyperstimulation syndrome and HL are entities in continuum. Ultrasound Obstetrics and Gynecology 24 675–678.[CrossRef]
Heckert LL, Daley IJ & Griswold MD 1992 Structural organization of the follicle-stimulating hormone receptor gene. Molecular Endocrinology 6 70–80.
Al-Hendy A, Moshynska O, Saxena A & Feyles V 2000 Association between mutations of the follicle-stimulating-hormone receptor and repeated twinning. Lancet 356 914.[CrossRef][Web of Science][Medline]
Hugues JN 2002 Ovarian stimulation for assisted reproductive technologies. In Current Practices and Controversies in Assisted Reproduction, pp 102–125. Eds E Vayena, PJ Rowe & PD Griffin. World Health Organization: Geneva, Switzerland.
Huhtaniemi I 2000 The Parkes lecture. Mutations of gonadotrophin and gonadotrophin receptor genes: what do they teach us about reproductive physiology? Journal of Reproduction and Fertility 119 173–186.[Abstract]
Kerkela E, Skottman H, Friden B, Bjuresten K, Kere J & Hovatta O 2007 Exclusion of coding-region mutations in luteinizing hormone and follicle-stimulating hormone receptor genes as the cause of ovarian hyperstimulation syndrome. Fertility and Sterility 87 603–606.[CrossRef][Web of Science][Medline]
Langer JE & Coleman BG 2007 Case 1: diagnosis: hyperreactio luteinalis complicating a normal pregnancy. Ultrasound Quarterly 23 63–66.[CrossRef][Medline]
De Leener A, Montanelli L, Van Durme J, Chae H, Smits G, Vassart G & Costagliola S 2006 Presence and absence of follicle-stimulating hormone receptor mutations provide some insights into spontaneous ovarian hyperstimulation syndrome physiopathology. Journal of Clinical Endocrinology and Metabolism 91 555–562.
Mathur RS, Akande AV, Keay SD, Hunt LP & Jenkins JM 2000 Distinction between early and late ovarian hyperstimulation syndrome. Fertility and Sterility 73 901–907.[CrossRef][Web of Science][Medline]
Montanelli L, Delbaere A, Carlo C, Nappi C, Smits G, Vassart G & Costagliola S 2004 A mutation in the follicle-stimulating hormone receptor as a cause of familial spontaneous ovarian hyperstimulation syndrome. Journal of Clinical Endocrinology and Metabolism 89 1255–1258.[Abstract]
Morken NH, Friberg-Otterstad UM & Kahn JA 2007 Hyperreactio luteinalis, presented as an acute abdomen. Acta Obstetricia et Gynecologica Scandinavica 86 104–106.[CrossRef][Web of Science][Medline]
O'Leary CM, de Klerk N, Keogh J, Pennell C, de Groot J, York L, Mulroy S & Stanley FJ 2007 Trends in mode of delivery during 1984–2003: can they be explained by pregnancy and delivery complications? British Journal of Obstetrics and Gynaecology 114 855–864.
Perez Mayorga M, Gromoll J, Behre HM, Gassner C, Nieschlag E & Simoni M 2000 Ovarian response to follicle-stimulating hormone (FSH) stimulation depends on the FSH receptor genotype. Journal of Clinical Endocrinology and Metabolism 85 3365–3369.
Qasim SM, Karacan M & Kemmann E 1997 An eight year review of hospitalization for ovarian hyperstimulation syndrome. Clinical and Experimental Obstetrics and Gynecology 24 49–52.
Rabau E, David A, Serr DM, Mashiach S & Lunenfeld B 1967 Human menopausal gonadotropins for anovulation and sterility. Results of 7 years of treatment. American Journal of Obstetrics and Gynecology 98 92–98.[Web of Science][Medline]
Rizk B 2006 Ovarian Hyperstimulation Syndrome: Epidemiology, Pathophysiology, Prevention and Management. Cambridge University Press, New York, USA.
Sipila K & Aula P 2002 Database for the mutations of the Finnish disease heritage. Human Mutation 19 16–22.[CrossRef][Web of Science][Medline]
Smits G, Olatunbosug O, Delbaere A, Pierson R, Vassart G & Costagliola S 2003 Ovarian hyperstimulation syndrome due to a mutation in the follicle stimulating hormone receptor. New England Journal of Medicine 349 760–766.
Suzuki S 2004 Comparison between spontaneous ovarian hyperstimulation syndrome and hyperreactio luteinalis. Archives of Gynecology and Obstetrics 269 227–229.[CrossRef][Medline]
Vasseur C, Rodien P, Beau I, Desroches A, Gerard C, de Poncheville L, Chaplot S, Savagner F, Croue A, Mathieu E et al. 2003 A chorionic gonadotropin-sensitive mutation in the follicle-stimulating hormone receptor as a cause of familial gestational spontaneous ovarian hyperstimulation syndrome. New England Journal of Medicine 349 753–759.
Wang TH, Horng SG, Chang CL, Wu HM, Tsai YJ, Wang HS & Soong YK 2002 Human chorionic gonadotropin-induced ovarian hyperstimulation syndrome is associated with up-regulation of vascular endothelial growth factor. Journal of Clinical Endocrinology and Metabolism 87 3300–3308.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
