| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
RESEARCH |
Division of Cell Sciences, University of Glasgow Veterinary School, Institute of Comparative Medicine, Bearsden Road, Glasgow G61 1QH, UK and 1 William Harvey Research Institute, Molecular Endocrinology Centre, Barts and The London, Queen Mary, University of London, London EC1M 6BQ, UK
Correspondence should be addressed to P J OShaughnessy; Email: p.j.oshaughnessy{at}vet.gla.ac.uk
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
In support of a mesonephric origin of fetal Leydig stem cells, it has been suggested that fetal Leydig cells and adrenocortical cells share a common origin based on expression patterns of Sf-1 in the developing gonadal ridge (Hatano et al. 1996). The adrenal gland develops adjacent to the gonad at the same time and these authors suggest that both cell types share a common precursor cell which arises around 10.5 dpc at the cranial end of the mesonephros. This hypothesis is supported by the similarities that exist between fetal adrenal and fetal Leydig cells. Both are regulated by pituitary hormones and are primarily steroidogenic cells sharing a common steroidogenic pathway from cholesterol to progesterone. The major steroid secreted by the cells depends on the presence of 17
-hydroxylase (CYP17A1) and 17ß-hydroxysteroid dehydrogenase (HSD17b3) in the testis and 21-hydroxylase (CYP21A1) and 11ß-hydroxylase (CYP11B1) in the adrenocortex although CYP17A1 has been shown to be expressed in the fetal adrenal (Heikkila et al. 2002). In further support of the concept that fetal adrenal and fetal Leydig cells may share a common precursor, we have shown recently that fetal Leydig cells express the melanocortin type 2 receptor (MC2R) and that they are sensitive to adrenocorticotrophic hormone (ACTH), the principal trophic stimulator of the adrenal cortex (Johnston et al. 2007). In addition, adrenocortical cells will express the luteinising hormone (LH) receptor and will respond to LH following hyperstimulation (Kero et al. 2000). One of the major differences between the two cell types, therefore, is the expression of CYP21A1 and CYP11B1 in the adrenal cortex which allows secretion of corticosteroids. In order to determine whether expression of these enzymes defines a clear difference between adrenocortical and Leydig cells, we set out to establish whether Cyp21a1 and Cyp11b1, and associated enzyme activity, are expressed in the fetal testis and to characterise that expression.
| Results |
|---|
|
|
|---|
|
|
|
|
-hydroxyprogesterone and androgen (androstenedione plus testosterone). There was also, however, low but clear metabolism to deoxycorticosterone and 11-deoxycortisol which would both be formed by 21-hydroxylase activity. Confirmation of the identity of the 21-hydroxylated products was obtained through HPLC analysis following initial TLC separation. There was no clear further metabolism of these products to corticosterone or cortisol in this or similar experiments. To determine whether the neonatal testis expresses 11ß-hydroxylase activity homogenate was incubated with [3H]deoxycorticosterone. Under these conditions, we were unable to detect activity associated with [3H]corticosterone following TLC and HPLC separation of products.
|
| Discussion |
|---|
|
|
|---|
CYP21A1 converts progesterone to deoxycorticosterone and is the essential first step in glucocorticoid synthesis. Our studies show that the enzyme is expressed in the fetal testis with expression declining markedly after birth. During development, two populations of Leydig cells arise sequentially. The fetal Leydig cells arise soon after testis differentiation in the mouse and are subsequently replaced, at least functionally, by the adult population which starts to develop in the post-natal, pre-pubertal period (Baker et al. 1999, Nef & Parada 1999). The pattern of expression of Cyp21a1 determined by real-time PCR would be consistent, therefore, with expression in the fetal Leydig cells. Residual expression of Cyp21a1 in the adult may be due to the persistence of fetal Leydig cells in the adult or to low expression in the adult cell population. It has been shown previously that CYP21A1 is not detectable by Western blotting in the adult testis which is consistent with the low levels of expression seen by real-time PCR (Hu et al. 2002). Interestingly, however, in Cyp11a1-null mice, there is detectable expression of CYP21A1 in the interstitial tissue probably due to increased levels of ACTH or LH in these mice (Hu et al. 2002). It has previously been reported that extra-adrenal 21-hydroxylase activity in the human and adult rat is not mediated through Cyp21a1 (Mellon & Miller 1989). It is clear, however, from the PCR/Southern blots and from sequencing of PCR products that Cyp21a1 is expressed in the fetal mouse testis. Failure to detect Cyp21a1 in the adult rat testis is consistent with this enzyme being predominantly associated with the fetal testis, while lack of expression in the fetal human testis may indicate a species difference (Mellon & Miller 1989).
The final step in glucocorticoid biosynthesis is 11ß-hydroxylation of deoxycorticosteroids by CYP11B1. It has previously been reported that the fetal testis expresses Cyp11b1 (Hatano et al. 1996, Val et al. 2006) and the results reported here confirm that full-length transcripts are expressed in the fetal mouse testis. Failure to detect CYP11B1 protein or 11ß-hydroxylase activity in the fetal testis suggests, however, that suppression of translation may occur. Regulation of translation through, for example, microRNA is an established developmental mechanism (Good 2003) which would, in this case, act to prevent significant corticosterone production by the testis. This is consistent with the very low levels of corticosteroids detected in medium from fetal testes incubated in vitro (OShaughnessy et al. 2003). Corticosteroids act to inhibit Leydig cell function and in the adult rat 11ß-hydroxysteroid dehydrogenase (11ßHSD) oxidises corticosteroids and thereby limits their effect (Hardy et al. 2005). Fetal and neonatal animals lack 11ßHSD (Phillips et al. 1989) and inhibition of Cyp11b1 translation may, therefore, be a protective mechanism that prevents high levels of corticosteroid production by the testis. This hypothesis would suggest that CYP21A1 may not play a significant role in normal Leydig cell function and that expression of Cyp21a1 may be a remnant of Leydig cell evolution (OShaughnessy et al. 2006).
Expression of Cyp21a1 and Cyp11b1 in the fetal testis is further evidence of a link between the developing testis and adrenal. It is likely that this expression is in a subpopulation of fetal Leydig cells and this subpopulation may form during Leydig cell differentiation from pluripotent stem cells that arise from the coelomic epithelium (Yao et al. 2002, Cui et al. 2004) or may arise separately from the mesonephros towards the end of initial testis differentiation (Val et al. 2006). Thus, in the fetal testis, most or all fetal Leydig cells express MC2R and respond to ACTH (Johnston et al. 2007) while a subpopulation of cells also expresses genes encoding adrenal steroidogenic enzymes.
| Materials and Methods |
|---|
|
|
|---|
Cell isolation and incubation
Dispersed testicular cells from neonatal mice were prepared by collagenase treatment of whole testes as previously described (Stalvey & Payne 1983). Testes from six animals were dispersed at 37 °C in DMEM/F12 containing 1 mg/ml collagenase (Worthington CLS type 4, purchased from Lorne Laboratories Ltd, Twyford, UK), and isolated cells were filtered through a nylon sieve with a pore size of 50 µm. Aliquots of isolated cells (1 ml total) were incubated for 3 h at 37 °C in DMEM/F12 in an atmosphere of 5% CO2 and in the presence or absence of hCG (10–7 M) or ACTH (1–24) (10–9 M; Sigma–Aldrich Co). At the end of the incubation period, cells and medium were separated by centrifugation at 150 g and the cell pellet stored in liquid N2.
RT-PCR and Southern blotting
Total RNA was extracted using Trizol (Life Technologies). Isolated RNA was reverse transcribed using random hexamers and Moloney murine leukaemia virus reverse transcriptase (Superscript II, Invitrogen) as described previously (OShaughnessy & Murphy 1993, OShaughnessy et al. 1994). This cDNA was used as a template for subsequent PCRs. The PCRs were carried out in a total volume of 50 µl using a hot-start Taq polymerase (1.25 units AmpliTaq Gold, Applied Biosystems, Warrington, Cheshire, UK) in buffer (15 mM Tris–HCl (pH 8.0), 50 mM KCl and 2.5 mM MgCl2) containing dNTPs (0.2 mM each), primers (200 nM each) and template. Reactions were started by 10 min at 95 °C followed by up to 35 cycles of 95 °C for 30 s, 60 °C for 30 s and 72 °C for 2 min.
The primers used to amplify the full-length coding region of Cyp21a1 and Cyp11b1 were: Cyp21a1, forward: ATGCTGCTACCTGGGCTGCTG and reverse: TCAAGGAC-GCTCACCCTGGTCT; Cyp11b1, forward: GATGACAATG-GCTCTCAGGGTGAC and reverse: GAGAGGGCAATG-TGTCATCAGA.
An internal probe for Southern hybridisation of Cyp21a1 was amplified by PCR from adrenal cDNA using primers TGCTGTTGCTGCTGCTAGCTGG and CAACGTGCTGTCC-TTGTCTCCAAA while a probe for Cyp11b1 was amplified using TCAGGGTGACAACATATGTGTGGCT and CCATTCTG-GCCCATTTAGCAA. These primers generate amplicons of 511 and 411 bp respectively. The products of these reactions were gel-purified, sequenced and used for Southern hybridisation as described below.
Real-time PCR
Levels of specific mRNA species were measured by real-time PCR using the SYBR Green method following RT of the isolated RNA. Real-time PCRs were performed in a 96-well plate format using a Stratagene MX3000 cycler. Reactions contained 5 µl 2 x SYBR MasterMix (Stratagene, Amsterdam), primer (100 nM) and template in a total volume of 10 µl. The thermal profile used for amplification was 95 °C for 8 min followed by 40 cycles of 95 °C for 20 s, 63 °C for 20 s and 72 °C for 30 s. At the end of the amplification phase, a melting curve analysis was carried out on the products formed and gel electrophoresis was carried out on representative samples to confirm product size.
Primers for real-time PCR were designed using parameters previously described (Czechowski et al. 2004) and the amplicons all crossed at least one exon/exon boundary. The primers used were:
|
Sequencing
PCR products were sequenced directly or were ligated into plasmid using TOPO TA cloning kits (Invitrogen) and sequence obtained from the cloned plasmid. Sequencing reactions were carried out using big dye terminator cycle sequencing kits (Applied Biosystems).
Southern hybridisation
For Southern hybridisation of PCR products, the DNA was transferred from agarose gels to nitrocellulose membranes and hybridised with a [32P]labelled cDNA probe prepared as above (OShaughnessy et al. 1994).
Enzyme activity
Steroidogenic enzyme activity was measured in homogenates of fetal testis and adrenal using tritiated substrate as described previously (OShaughnessy et al. 2000). Tissues were homogenised in PBS and incubated with [1,2,6,7-3H]progesterone (Amersham) or [1,2,6,7-3H]21-hydroxyprogesterone at 37 °C in the presence of 1 mM NADPH. The [3H]21-hydroxyprogesterone substrate was generated from [3H]progesterone by incubation with adult mouse adrenal homogenate. At the end of the incubation period, 50 µg non-radioactive carrier steroids were added to each sample along with [14C]testosterone and [14C]androstenedione (2000 d.p.m./sample) to measure recovery. Samples were extracted twice with 5 ml toluene and steroids were separated by TLC using polyester-backed silica gel plates (Whatman Ltd, Maidstone, UK). A two-step TLC -separation was used; initially, plates were developed in -chloroform/methanol (97/3) which separated cortisol, corticosterone, deoxycorticosterone, 11-deoxycortisol, testosterone and 17-hydroxyprogesterone. Progesterone and androstenedione were not separated in this system and they were eluted from the first TLC plate and separated by subsequent TLC in chloroform/ether (7/1). The identity of products was confirmed by reverse-phase HPLC using a C18 4 µm column as described previously (Mannan & OShaughnessy 1988).
Immunohistochemistry
Neonatal testes were fixed in 4% paraformaldehyde for 1 h and then washed in 70% ethanol, dehydrated and embedded in paraffin. Sections (5 µm) were mounted on glass slides, dewaxed and rehydrated. Endogenous biotin was blocked using an avidin/biotin blocking kit (R&D systems Europe Ltd, Abingden, UK) and sections were incubated with primary antibody overnight at 4 °C. The antibodies used were rabbit anti-human CYP21A1 (LAE Biotech International, Rockville, MD, USA), mouse anti-rat CYP11B1 monoclonal (Chemicon International, Temecula, CA, USA) and rabbit anti-bovine P450scc (gift from A H Payne). Sections were washed and incubated for 30 min with biotinylated secondary antibody (R&D systems Europe Ltd). Bound antibody was visualised using 3,3-diaminobenzidine tetrahydrochloride (R&D systems Europe Ltd). Negative controls without the primary antibody were included in each experiment.
Statistical analysis
Data were analysed by ANOVA followed by Fishers multiple comparison test.
| Acknowledgements |
|---|
|
|
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Baker PJ, Sha JA, McBride MW, Peng L, Payne AH & OShaughnessy PJ 1999 Expression of 3ß-hydroxysteriod dehydrogenase type I and VI isoforms in the mouse testis during development. European Journal of Biochemistry 260 911–916.[Web of Science][Medline]
Byskov A 1986 Differentiation of mammalian embryonic gonad. Physiological Reviews 66 77–112.
Cui S, Ross A, Stallings N, Parker KL, Capel B & Quaggin SE 2004 Disrupted gonadogenesis and male-to-female sex reversal in Pod1 knockout mice. Development 131 4095–4105.
Czechowski T, Bari RP, Stitt M, Scheible WR & Udvardi MK 2004 Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel root- and shoot-specific genes. Plant Journal 38 366–379.[CrossRef][Web of Science][Medline]
Good L 2003 Translation repression by antisense sequences. Cellular and Molecular Life Sciences 60 854–861.[Web of Science][Medline]
Hardy MP, Gao HB, Dong Q, Ge R, Wang Q, Chai WR, Feng X & Sottas C 2005 Stress hormone and male reproductive function. Cell Tissue Research 322 147–153.[CrossRef][Web of Science][Medline]
Hatano O, Takakusu A, Nomura M & Morohashi K 1996 Identical origin of adrenal cortex and gonad revealed by expression profiles of Ad4BP/SF-1. Genes Cells 1 663–671.[Abstract]
Heikkila M, Peltoketo H, Leppaluoto J, Ilves M, Vuolteenaho O & Vainio S 2002 Wnt-4 deficiency alters mouse adrenal cortex function, reducing aldosterone production. Endocrinology 143 4358–4365.
Hu MC, Hsu NC, El Hadj NB, Pai CI, Chu HP, Wang CK & Chung BC 2002 Steroid deficiency syndromes in mice with targeted disruption of CYP11A1. Molecular Endocinology 16 1943–1950.[CrossRef]
Ikeda Y, Shen WH, Ingraham HA & Parker KL 1994 Developmental expression of mouse steroidogenic factor-1, an essential regulator of the steroid hydroxylases. Molecular Endocinology 8 654–662.[CrossRef]
Jeays-Ward K, Hoyle C, Brennan J, Dandonneau M, Alldus G, Capel B & Swain A 2003 Endothelial and steroidogenic cell migration are regulated by WNT4 in the developing mammalian gonad. Development 130 3663–3670.
Johnston H, King P & OShaughnessy PJ 2007 Effects of adrenocorticotrophic hormone and expression of the melanocortin-2 receptor in the neonatal mouse testis. Reproduction 133 1181–1187.
Karl J & Capel B 1998 Sertoli cells of the mouse testis originate from the coelomic epithelium. Developmental Biology 203 323–333.[CrossRef][Web of Science][Medline]
Kero J, Poutanen M, Zhang FP, Rahman N, McNicol AM, Nilson JH, Keri RA & Huhtaniemi IT 2000 Elevated luteinizing hormone induces expression of its receptor and promotes steroidogenesis in the adrenal cortex. Journal of Clinical Invesigation 105 633–641.
Mannan MA & OShaughnessy PJ 1988 Ovarian steroid metabolism during post-natal development in the normal mouse and in the adult hypogonadal (hpg) mouse. Journal of Reproduction and Fertility 82 727–734.
Mellon SH & Miller WL 1989 Extraadrenal steroid 21-hydroxylation is not mediated by P450c21. Journal of Clinical Invesigation 84 1497–1502.
Merchant-Larios H & Moreno-Mendoza N 1998 Mesonephric stromal cells differentiate into Leydig cells in the mouse fetal testis. Experimental Cell Research 244 230–238.[CrossRef][Web of Science][Medline]
Nef S & Parada LF 1999 Cryptorchidism in mice mutant for Insl3. Nature Genetics 22 295–299.[CrossRef][Web of Science][Medline]
OShaughnessy PJ & Murphy L 1993 Cytochrome P-450 17
-hydroxylase protein and mRNA in the testis of the testicular feminized (Tfm) mouse. Journal of Molecular Endocrinology 11 77–82.
OShaughnessy PJ, Marsh P & Dudley K 1994 Follicle-stimulating hormone receptor mRNA in the mouse ovary during post-natal development in the normal mouse and in the adult hypogonadal (hpg) mouse: structure of alternate transcripts. Molecular and Cellular Endocrinology 101 197–201.[CrossRef][Web of Science][Medline]
OShaughnessy PJ, Baker PJ, Heikkila M, Vainio S & McMahon AP 2000 Localization of 17ß-hydroxysteroid dehydrogenase/17-ketosteroid reductase isoform expression in the developing mouse testis -androstenedione is the major androgen secreted by fetal/neonatal leydig cells. Endocrinology 141 2631–2637.
OShaughnessy PJ, Fleming LM, Jackson G, Hochgeschwender U, Reed P & Baker PJ 2003 Adrenocoricotrophic hormone directly stimulates testosterone production by the fetal and neonatal mouse testis. Endocrinology 144 3279–3284.
OShaughnessy PJ, Baker PJ & Johnston H 2006 The foetal Leydig cell–differentiation, function and regulation. International Journal of Andrology 29 90–95.[CrossRef][Web of Science][Medline]
Phillips DM, Lakshmi V & Monder C 1989 Corticosteroid 11 beta-dehydrogenase in rat testis. Endocrinology 125 209–216.
Stalvey JR & Payne AH 1983 Luteinizing hormone receptors and testosterone production in whole testes and purified Leydig cells from the mouse: differences among inbred strains. Endocrinology 112 1696–1701.
Val P, Jeays-Ward K & Swain A 2006 Identification of a novel population of adrenal-like cells in the mammalian testis. Developmental Biology 299 250–256.[CrossRef][Web of Science][Medline]
Vergouwen RPFA, Jacobs SGPM, Huiskamp R, Davids JAG & de Rooij DG 1991 Proliferative activity of gonocytes, sertoli cells and interstitial cells during testicular development in mice. Journal of Reproduction and Fertility 93 233–243.
Yao HH, Whoriskey W & Capel B 2002 Desert Hedgehog/Patched 1 signaling specifies fetal Leydig cell fate in testis organogenesis. Genes and Development 16 1433–1440.
This article has been cited by other articles:
![]() |
H. A. LaVoie and S. R. King Transcriptional Regulation of Steroidogenic Genes: STARD1, CYP11A1 and HSD3B Exp Biol Med, August 1, 2009; 234(8): 880 - 907. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |