| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
RESEARCH |
Department of Population Health and Reproduction, University of California, Davis, California 95616, USA
Correspondence should be addressed to B A Ball; Email: baball{at}ucdavis.edu
| Abstract |
|---|
|
|
|---|
-NOX5 revealed one major protein in equine testis and other tissues. Immunolocalization of NOX5 showed labeling over the rostral sperm head with some labeling in the equatorial and post-acrosomal regions. In the testis, there was abundant staining in the adluminal region of the seminiferous tubules associated with round and elongating spermatids. The RT-PCR and sequence analysis revealed a high homology with human NOX5. This study demonstrates that NOX5 is present in equine spermatozoa and testes and therefore represents a potential mechanism for ROS generation in equine spermatozoa. | Introduction |
|---|
|
|
|---|
In equine spermatozoa, NAD(P)H-dependent generation of ROS can be detected based upon nitroblue tetrazolium (NBT) reduction as well as by cytochrome c reduction by isolated equine sperm membrane preparations (Sabeur & Ball 2006). Cytochemical localization of NAD(P)H-dependent ROS generation by equine spermatozoa demonstrates NBT labeling over both the sperm midpiece and the sperm head, which suggests that superoxide generation may be attributed to two different sources. Labeling over the sperm midpiece may be attributed to the activity of mitochondrial oxidoreductases, whereas labeling over the sperm head may be attributed to a membrane-associated NAD(P)H oxidase (Sabeur & Ball 2006). The generation of superoxide anion in these systems was reduced by the flavoprotein inhibitor, diphenyleneiodonium, suggesting that an NAD(P)H oxidase may be responsible for NAD(P)H-dependent generation of ROS in equine spermatozoa (Sabeur & Ball 2006).
One possible candidate for NAD(P)H-dependent generation of ROS is the family of NADPH oxidases (NOX) that have been characterized for a number of cell and tissue types (Lambeth 2002, Krause 2004, Sabeur et al. 2004). The NOX family of NOX consists of seven known members, which are important in a variety of somatic tissues and include NOX 1–5 as well as dual oxidases (DUOX) 1–2 (Lambeth 2002, 2004, Krause 2004). One member of the NOX family, NOX5, is expressed in testis (Banfi et al. 2001, Cheng et al. 2001) and has been suggested as a possible candidate for low-level ROS generation in spermatozoa (Baker et al. 2003). NOX5 is a calcium-activated NOX that has been identified in human testis and lymphocyte-rich areas of spleen and lymph nodes (Banfi et al. 2001). NOX5 is expressed in pachytene spermatocytes; however, the function of NOX5 in mature spermatozoa has not been defined. It appears possible that NOX5 acts as a calcium-dependent mechanism for generation of ROS by spermatozoa; however, this remains to be established. Therefore, the objective of the current study was to characterize the presence of NOX5 mRNA and protein in equine testis and spermatozoa.
| Materials and Methods |
|---|
|
|
|---|
Expression of NOX5 transcript by northern blot analysis of equine testis
The presence of equine NOX5 transcript in equine testis was investigated by Northern blot analysis of poly-adenylated (poly(A)) RNA with a labeled human NOX5 cDNA probe. A human NOX5 plasmid DNA insert of 771 nucleotides (Banfi et al. 2001) was radiolabeled with 32P-dCTP using a random-primed labeling system (Amersham). Polyadenylated mRNA was extracted from triazol–total RNA using the poly(A) purist kit from Ambion (Austin, TX, USA). RNA samples were denaturated and run on a formaldehyde/formamide gel. The resolved RNA was transferred to a nylon membrane (MSI, Westboro, MA, USA) and u.v. cross-linked. After a 2-h prehybridization at 42 °C, the membrane was incubated in a hybridization solution (ExpressHyb; BD Biosciences, Palo Alto, CA, USA) containing –5 ng of radiolabeled cDNA (1 x 106 c.p.m./ml) at 65 °C overnight. Unbound probe was removed by washing twice with 1 x SSC, 0.1% SDS at 20 °C, then twice with 1 x SSC, 1%SDS at 50 °C. The membranes were exposed for autoradiography at –70 °C for 72 h.
RT-PCR of NOX5 from equine testis
Equine testis poly(A) RNA was isolated from Trizol Reagent as described above. This poly(A) RNA was subsequently used as template for first strand synthesis using oligo-dT primer (0.5 µg/µl, Invitrogen) and AMV reverse transcriptase (Promega). After RT, PCR amplification was conducted with Taq DNA polymerase, and the following primers for the first round PCR, followed by a second round with nested specific human or equine primers at 3' and 5'-end. The equine primers were deduced from the equine genomic sequence for NOX5 ß (testis isoform). For the first round of amplification, the primer sequences from 5' to 3' were: NOX700 forward, GACTGCAGCTTCATCGCGGTGCTG and NOX1933; reverse, GTTGGCCAGGAGGT-CAAGGGCCATCTG. For the second round of amplification, primers were NOX700 forward and Nox1806 reverse, CCACTCGAAAGACCGCTGGTCTCT. Sequence was analyzed using the BLAST program (NCBI server at the National Library of Medicine/NIH) and the alignments were performed using multiple sequence alignment (Corpet 1988).
Expression of NOX5 protein by western blot analysis
Tissue extraction
Frozen equine testes and other reproductive and somatic tissues were stored at –70 °C prior to extraction. The tissues (20 g) were cut in small pieces (1 x 1 cm) and homogenized in 50 ml Tris buffer, pH 7.4 using a blender (UltraTurrex 95) at a frequency of 13 500 r.p.m. for 15 s five times. Protease inhibitors were added immediately to the Tris buffer: phenylmethylsulphonyl fluoride (500 µM), pepstatin (1 µM), leupeptin (5 µM) and antipain (25 µM). The homogenized sample was passed through cheesecloth and centrifuged twice at 20 000
for 30 min (Sabeur et al. 2001). The resulting pellet was suspended in 6–10 ml Tris buffer with protease inhibitors and triton X-100 was added to a final concentration of 1%. The suspension was mixed overnight (5 °C) and then sonicated using six pulses (15 s each) of a sonic dismembrenator 60 (Fisher Scientific, Pittsburgh, PA, USA). The sonicated membrane was centrifuged at 45 000 g for 60 min, and the supernatant containing the solubilized protein was stored at –20 °C.
The equine tissues and sperm-detergent extracts were solubilized in SDS and subjected to SDS-PAGE in 12% gels followed by Western blotting. Standard Western blotting procedures were used (Towbin et al. 1979). Blots were probed with a
-NOX5 polyclonal antibody (39 µg/ml). Anti-NOX5 was generated in a rabbit against the EF-hand containing region of NOX5, which was generated as a glutathione S-transferase-fusion protein (Banfi et al. 2004). The resulting antiserum was purified against immobilized glutathione according to the manufacturers recommended protocol (Pierce). The affinity purified antiserum was used for immunoblotting and subsequent immunolabeling experiments in ejaculated spermatozoa. For western blotting, a horseradish peroxidase conjugated secondary antibody (1:5000) was used, and proteins were detected with ECL.
Immunocytochemical localization of NOX5 in equine spermatozoa
Ejaculated equine spermatozoa were diluted in Tyrodes albumin, lactate, pyruvate (72 mM NaCl, 25 mM KCl, 25 mM NaHCO3, 0.36 mM NaH2PO4, 2 mM CaCl.2H20, 0.4 mM MgCl.6H20, 25 mM HEPES, 5 mM glucose, 21.6 mM Na lactate and 0.25 mM Na pyruvate) with 1% BSA (w/v), washed by centrifugation (300
, 10 min) and resuspended at 50 million cells/ml in Dulbeccos PBS (DPBS). Washed spermatozoa were permeabilized in 95% methanol for 5 min, centrifuged 8 min at 300
, resuspended in DPBS and centrifuged again for 10 min. The cells were blocked in DPBS-5% BSA for 1 h before incubation with affinity purified
-NOX five antibody (58 µg/ml in PBS) overnight at 4 °C. Spermatozoa were washed with PBS ( x 3, 5 min), and blocked with 5% BSA-PBS ( x 2, 5 min, w/v), then incubated with secondary antibody, fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG for a 1 h (1:100 in PBS). Samples were then washed twice in PBS and mounted with 1,4-diazabicyclo- (2.2.2) octane, coverslipped, sealed and examined with epifluorescence microscopy. Control experiments were run with secondary antibody only or with replacement of primary antibody with rabbit nonimmune serum.
Immunohistochemical localization of NOX5 in equine testis
The testes of adult stallions were fixed in 4% paraformaldehyde (v/v). After a series of graded ethanol incubations, tissues were embedded in paraffin and sectioned at 5 µm. The tissue sections were then deparaffinized and hydrated through xylenes and a graded ethanol series. Immunoperoxidase staining was performed with the vectastain ABC-Elite kit (Vector Laboratories, Burlingame, CA, USA). The sections were incubated for 30 min in 0.3% H2O2–methanol to quench endogenous peroxidase activity. Antigen retrieval was performed by heating sections for 20 min at 93 °C in unmasking buffer (Vector Laboratories) as previously described (Corbin et al. 2003). After a wash in PBS-0.3% TX-100, the sections were incubated for 20 min with diluted blocking serum, washed and incubated with an
-NOX5 antibody (Brar et al. 2003; 1:100) overnight, at 4 °C. The sections were then incubated for 30 min with biotinylated horseradish peroxidase linked-secondary antibody (1:200) followed by incubation in ABC reagent and developed with the substrate 3-amino-9-ethylcarbazole according to the manufacturer. The sections were counterstained with hematoxylin. Normal rabbit serum was used as a negative control.
| Results |
|---|
|
|
|---|
-NOX5 revealed one major protein in equine testis with a molecular mass of –90 kDa. In ejaculated equine sperm, three additional proteins were detected with molecular masses of 70, 35 and 29 kDa (Fig. 2
|
|
|
-NOX5 revealed abundant staining in the adluminal region of the seminiferous tubules associated with the developing acrosomal cap of round spermatids (Fig. 5
|
|
|
| Discussion |
|---|
|
|
|---|
Banfi et al.(2001) demonstrated the presence of NOX5 mRNA in human testis with expression detected primarily in pachytene spermatocytes and round spermatids. Ours is the first study to examine expression of NOX5 protein in testis and spermatozoa. NOX5 was localized in round and elongating spermatids in the testis and was localized primarily to the rostral sperm head in ejaculated spermatozoa. The localization of NOX5 protein in equine spermatozoa and spermatids is consistent with expression of mRNA observed by in situ hybridization in Banfis study (Banfi et al. 2001). NOX5 mRNA (2.9 kb) was detected by Northern analysis in both human and equine testis and was similar in size to the human testis transcript (Banfi et al. 2001). Likewise, the 90 kDa protein detected on immunoblots of equine testis and spermatozoa in the present study compares favorably with the predicted size of human testis isoform of NOX5 (719 amino acids 82 kDa; Banfi et al. 2001) as well as an 85 kDa protein detected in human prostatic carcinoma cells (Brar et al. 2003). The appearance of lower molecular weight proteins on immunoblots of equine spermatozoa, but not equine testis, probed with
-NOX5 is likely due to proteolytic cleavage.
NOX5 have been recently cloned and identified in a variety of tissues including human testis and lymphocytes as well as in smooth muscle, uterus, ovary, prostate, pancreas and a variety of fetal tissues (Banfi et al. 2001, Cheng et al. 2001, Brar et al. 2003). Two types of NOX5 have been described (Vignais 2002). NOX5-L (long) has calcium-binding EF hands and is present as four different isoforms in testis and spleen (Banfi et al. 2001), whereas the short splice variant (NOX5-S) lacks the EF hands and is expressed in fetal kidney and in vascular endothelial cells (Cheng et al. 2001, Bickel et al. 2005). Thus, it appears that NOX5 may be important in ROS-mediated cell signaling events in a variety of reproductive and somatic tissues. Consistent with these observations, we detected NOX5 in a variety of reproductive and somatic tissues in the horse.
NOX5 appears unique among the family of NOX in that its activation does not require association with other regulatory subunits (such as p22phox; Geiszt & Leto 2004). NOX5 is activated directly by Ca2+binding to the N-terminal EF hands of the NOX5-L form (Banfi et al. 2001, 2004). In mature spermatozoa, NOX5 may act to couple an increase in intracellular Ca2+ with other cell-signaling events via an increase in ROS generation. This observation is supported by numerous studies, which have demonstrated that ROS generation by spermatozoa can be stimulated by treatment with calcium ionophore (Aitken et al. 1992, Ball et al. 2001, Burnaugh et al. 2007). Although the ROS generation by NOX5 requires a relatively high [Ca2+], the concentrations required are at least consistent with those generated during activation of spermatozoa (Banfi et al. 2004). Since NOX5 does not require assembly of regulatory subunits (as does NOX2), calcium activation leads to a rapid production of ROS similar to that observed when spermatozoa are treated with calcium ionophore. Phosphorylation of NOX5 appears to further increase the sensitivity of the enzyme to calcium, as evidenced by the increased response to calcium following treatment with phorbol esters (Jagnandan et al. 2006). Although studies to date have not conclusively demonstrated the role of NOX5 in ROS-mediated signal transduction in spermatozoa, it appears that NOX5 may be a candidate for generation of superoxide anion in equine spermatozoa.
The role of NOX in ROS generation by spermatozoa, however, remains controversial. Several authors suggest that putative ROS generation by spermatozoa in the presence of NAD(P)H is artifactual due to redox cycling of probes such as lucigenin (Ford 2004) and due to the presence of contaminating neutrophils in human semen or reduction of tetrazolium salts by the activity of P450 reductases in human or rodent spermatozoa (Baker et al. 2004). A number of other studies that do not rely on these methodologies, however, demonstrate generation of ROS by spermatozoa in response to NAD(P)H. In equine spermatozoa, NAD(P)H increased H2O2 generation as detected by the Amplex Red assay (Ball et al. 2001) as well as increased superoxide generation as detected by cytochrome c reduction (Sabeur & Ball 2006). Conclusive resolution of this controversy will likely involve ascribing ROS generation to NOX5 in mature spermatozoa.
In conclusion, this study demonstrates the expression of the NOX, NOX5, in equine testis with immuno-localization of NOX5 protein in round spermatids and in ejaculated equine spermatozoa. NOX5 may play a role in ROS-mediated signaling events in equine spermatozoa although further studies are required to directly establish the specific role of NOX5 in ROS generation by equine spermatozoa.
| Acknowledgements |
|---|
|
|
|---|
-NOX5 antisera were provided by Dr B Banfi and by Dr J D Lambeth. This research was supported by the John P Hughes Endowment; the Center for Equine Health with funds provided by the Oak Tree Racing Association, the State of California pari-mutuel fund, and contributions by private donors; and the United States Department of Agriculture National Research Initiative–Competitive Grants Program (No. 2002-35203-12260). The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work. | Footnotes |
|---|
| References |
|---|
|
|
|---|
Aitken RJ & Clarkson JS 1987 Cellular basis of defective sperm function and its association with the genesis of reactive oxygen species by human spermatozoa. Journal of Reproduction and Fertility 81 459–469.
Aitken RJ, Buckingham DW & West KM 1992 Reactive oxygen species and human spermatozoa: analysis of the cellular mechanisms involved in luminol- and lucigenin-dependent chemiluminescence. Journal of Cell Physiology 151 466–477.[CrossRef][Web of Science][Medline]
Aitken RJ, Paterson M, Fisher H, Buckingham DW & Van Duin M 1995 Redox regulation of tyrosine phosphorylation in human spermatozoa and its role in the control of human sperm function. Journal of Cell Science 108 2017–2025.[Abstract]
Aitken RJ, Buckingham DW, Harkiss D, Paterson M, Fisher H & Irvine DS 1996 The extragenomic action of progesterone on human spermatozoa is influenced by redox regulated changes in tyrosine phosphorylation during capacitation. Molecular and Cellular Endocrinology 117 83–93.[CrossRef][Web of Science][Medline]
Aitken RJ, Fisher HM, Fulton N, Gomez E, Knox W, Lewis B & Irvine S 1997 Reactive oxygen species generated by human spermatozoa is induced by exogenous NADPH and inhibited by the flavoprotein inhibitors diphenylene iodonium and quinacrine. Molecular Reproduction and Development 47 468–482.[CrossRef][Web of Science][Medline]
Aitken RJ, Harkiss D, Knox W, Paterson M & Irvine DS 1998 A novel signal transduction cascade in capacitating human spermatozoa characterised by a redox-regulated, cAMP-mediated induction of tyrosine phosphorylation. Journal of Cell Science 111 645–656.[Abstract]
Armstrong JS, Bivalacqua TJ, Chamulitrat W, Sikka S & Hellstrom -WJG 2002 A comparison of the NADPH oxidase in human sperm and white blood cells. International Journal of Andrology 25 223–229.[CrossRef][Web of Science][Medline]
Baker MA & Aitken RJ 2004 The importance of redox regulated pathways in sperm cell biology. Molecular and Cellular Endocrinology 216 47–54.[CrossRef][Web of Science][Medline]
Baker MA, Krutskikh A & Aitken RJ 2003 Biochemical entities involved in reactive oxygen species generation by human spermatozoa. Protoplasma 223 145–151.
Baker MA, Krutskikh A, Curry BJ, McLaughlin EA & Aitken RJ 2004 Identification of cytochrome P450-reductase as the enzyme responsible for NADPH-dependent lucigenin and tetrazolium salt reduction in rat epididymal sperm preparations. Biology of Reproduction 71 307–318.
Balaban RS, Nemoto S & Finkel T 2005 Mitochondria, oxidants, and aging. Cell 120 483–495.[CrossRef][Web of Science][Medline]
Ball BA, Vo AT & Baumber J 2001 Generation of reactive oxygen species by equine spermatozoa. American Journal of Veterinary Research 62 508–515.[CrossRef][Web of Science][Medline]
Banfi B, Molnar G, Maturana A, Steger K, Hegedus B, Demaurex N & Krause KH 2001 A Ca2+-activated NADPH, oxidase in testis, spleen, and lymph nodes. Journal of Biological Chemistry 276 37594–37601.
Banfi B, Tirone F, Durussel I, Knisz J, Moskwa P, Molnar GZ, Krause KH & Cox JA 2004 Mechanism of Ca2+ activation of the NADPH oxidase 5 (NOX5). Journal of Biological Chemistry 279 18583–18591.
Baumber J, Sabeur K, Vo A & Ball BA 2003 Reactive oxygen species promote tyrosine phosphorylation and capacitation in equine spermatozoa. Theriogenology 60 1239–1247.[CrossRef][Web of Science][Medline]
Bickel C, Petry A, Djordjevic K, Diemer K, Pogrebniak A, Bonello S, BelAiba RS, Acker H, Hess J & Gorlach A 2005 Endothelial cells express a distinct, functionally active NOX5 isoform. Pflugers Archiv: European Journal of Physiology 449 S19–S40.[CrossRef][Web of Science][Medline]
Brar SS, Corbin Z, Kennedy TP, Hemendinger R, Thornton L, Bommarius B, Arnold RS, Whorton AR, Sturrock AB, Huecksteadt TP, Quinn MT, Krenitsky K, Ardie KG, Lambeth JD & Hoidal JR 2003 NOX5 NAD(P)H, oxidase regulates growth and apoptosis in DU 145 prostate cancer cells. American Journal of Physiology. Cell Physiology 285 C353.
Burnaugh LM, Sabeur K & Ball BA 2007 Generation of superoxide anion by equine spermatozoa as detected by dihydroethidium. Theriogenology 67 580–589.[CrossRef][Web of Science][Medline]
Cheng G, Cao Z, Xu X, Meir EGV & Lambeth JD 2001 Homologs of gp91phox: cloning and tissue expression of Nox3, Nox4, and Nox5. Gene 269 131–140.[CrossRef][Web of Science][Medline]
Corbin CJ, Moran FM, Vidal JD, Ford JJ, Wise T, Mapes SM, Njar VC, Brodie AM & Conley AJ 2003 Biochemical assessment of limits to estrogen synthesis in porcine follicles. Biology of Reproduction 69 390–397.
Corpet F 1988 Multiple sequence alignment with hierarchical clustering. Nucleic Acids Research 16 10881–10890.
Ford WCL 2004 Regulation of sperm function by reactive oxygen species. Human Reproduction Update 10 387–399.
Geiszt M & Leto TL 2004 The Nox family of NAD(P)H oxidases: host defense and beyond. Journal of Biological Chemistry 279 51715–51718.
Godeas C, Tramer F, Micali F, Soranzo M, Sandri G & Panfili E 1997 Distribution and possible novel role of phospholipid hydroperoxide glutathione peroxidase in rat epididymal spermatozoa. Biology of Reproduction 57 1502–1508.[Abstract]
Jagnandan D, Church JE, Banfi B, Stuehr DJ, Marrero MB & Fulton DJR 2006 Novel mechanism of activation of NADPH oxidase 5(NOX5): calcium-sensitization via phosphorylation. Journal of Biological Chemistry 282 6494–6507.[CrossRef][Web of Science][Medline]
Krause KH 2004 Tissue distribution and putative physiologic function of NOX family NADPH oxidases. Japanese Journal of Infectious Diseases 57 S28–S29.[Medline]
Lambeth JDM 2002 NOX/DUOX family of nicotinamide adenine dinucleotide (phosphate) oxidases. Current Opinion in Hematology 9 11–17.[CrossRef][Web of Science][Medline]
Lambeth JD 2004 NOX, enzymes and the biology of reactive oxygen. Nature Reviews. Immunology 4 181–189.[CrossRef][Web of Science][Medline]
De Lamirande E & Gagnon C 1993a A positive role for the superoxide anion in triggering hyperactivation and capacitation of human spermatozoa. International Journal of Andrology 16 21–25.[Web of Science][Medline]
De Lamirande E & Gagnon C 1993b Human sperm hyperactivation and capacitation as parts of an oxidative process. Free Radical Biology and Medicine 14 157–166.[CrossRef][Web of Science][Medline]
Leclerc P, De Lamirande E & Gagnon C 1997 Regulation of protein-tyrosine phosphorylation and human sperm capacitation by reactive oxygen derivatives. Free Radical Biology and Medicine 22 643–656.[CrossRef][Web of Science][Medline]
OFlaherty C, Beorlegui N & Beconi MT 2003 Participation of superoxide anion in the capacitation of cryopreserved bovine sperm. International Journal of Andrology 26 109–114.[CrossRef][Web of Science][Medline]
OFlaherty C, de Lamirande E & Gagnon C 2006 Positive role of reactive oxygen species in mammalian sperm capacitation: triggering and modulation of phosphorylation events. Free Radical Biology and Medicine 41 528–540.[CrossRef][Web of Science][Medline]
Rivlin J, Mendel J, Rubinstein S, Etkovitz N & Breitbart H 2004 Role of hydrogen peroxide in sperm capacitation and acrosome reaction. Biology of Reproduction 70 518–522.
Sabeur K & Ball BA 2006 Detection of superoxide anion generation by equine spermatozoa. American Journal of Veterinary Research 67 701–706.[CrossRef][Web of Science][Medline]
Sabeur K, Vo AT & Ball BA 2001 Characterization of angiotensin-converting enzyme in canine testis. Reproduction 122 139–146.[Abstract]
Sabeur K, Ball BA, Krause KH & Banfi B 2004 NADPH, oxidase (NOX5) in equine spermatozoa and testis. Biology of Reproduction 70 (Supplement 1) 129.
Towbin H, Staehelin T & Gordon J 1979 Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedures and some applications. PNAS 76 4350–4354.
Tselkas K, Saratsis P, Karagianidis A & Samouilidis S 2000 Extracellular presence of reactive oxygen species (ROS) in fresh and frozen-thawed canine semen and their effects on some semen parameters. Deutsche Medizinische Wochenschrift 107 69–72.
Turrens JF & Boveris A 1980 Generation of superoxide anion by the NADH dehydrogenase of bovine heart mitochondria. Biochemical Journal 191 421–427.[Web of Science][Medline]
Vignais PV 2002 The superoxide generating NADPH oxidase: structural aspects and activation mechanism. Cellular and Molecular Life Sciences 59 1428–1459.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
K. Tremellen Oxidative stress and male infertility--a clinical perspective Hum. Reprod. Update, May 1, 2008; 14(3): 243 - 258. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |