| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
RESEARCH |
1 Departments of Pathobiology and 2 Biomedical Sciences, Ontario Veterinary College, University of Guelph, Guelph, Ontario, N1G 2W1, Canada 3 Division of Environmental and Evolutionary Biology, Institute of Biomedical and Life Sciences, University of Glasgow, Graham Kerr Building, Glasgow G12 8QQ, Scotland, UK
Correspondence should be addressed to M A Hayes; Email: ahayes{at}uoguelph.ca
| Abstract |
|---|
|
|
|---|
chain bands because these were undetectable in the capsule and uterine lavage. Uterocalin (p19) was detected in uterine lavage and capsule throughout fixation, but in yolk-sac fluid only before fixation. These studies indicate that intact ß2M is a major protein associated with the embryonic capsule before fixation, after which it undergoes limited proteolysis to a truncated ~8 kDa form that remains in the capsule after the conceptus is immobilized. | Introduction |
|---|
|
|
|---|
The capsule is essential for survival of the early embryo, protects it while it is mobile (Stout et al. 2005) and provides a regulatory interface between the trophoblast and the luminal epithelium of the uterus. Pregnancy failure due to embryonic loss is of great economic importance in horse breeding and many of the losses are incurred during the period that the capsule is present (Ball 1988, Baker et al. 1993, Carnevale et al. 2000, Morris & Allen 2002). In particular, Morris & Allen (2002) have shown that 16–17% of pregnancies diagnosed by ultrasound at about day 15 are subsequently lost, 60% of them between days 15 and 35. The concept that maternal secretions (uterine milk) nourish the early mammalian embryo is a very old one (Needham 1667, Harvey 1847, Marshall 1910, Ewart 1915, Amoroso 1952) that still underlies current research into the constituents of the secretion (Gray et al. 2005). The capsule might regulate the transfer of secreted uterine substances to the equine embryo. Selective binding of some proteins to the capsule supports the concept that the capsule is like a mailbox for delivery of various substances required by the embryo (Herrler et al. 1998, 2000b). For example, maternal p19/uterocalin binds to the capsule but is implicated mainly in delivery of lipids to the equine conceptus (Stewart et al. 1995, 2000, Crossett et al. 1996, 1998, Suire et al. 2001). Equine yolk-sac wall tissues before fixation express unusually large amounts of the GM2-activator protein (GM2AP) implicated in transport and catabolism of glycolipids (Quinn et al. 2006). They also produce insulin-like growth factor-binding protein 3 that binds insulin-like growth factor which is important for embryonic development (Herrler et al. 2000a). At the same time, a selectively permeable capsule composed largely of polysaccharides might shield embryonic antigens from immune rejection (Betteridge 1989) before non-classical major histocompatibility complex (MHC) class 1 expression and other immunoregulatory mechanisms prevent the rejection of paternal alloantigens in the invading trophoblast (Hunt et al. 2005, Trowsdale & Betz 2006).
Changes in the capsule and the endometrium might have functional roles in the process of fixation or its failure. Coincidently with fixation, the capsule becomes flaccid (Betteridge & Waelchli 2005) and loses sialic acid (Oriol et al. 1993a, 1993b, Chu et al. 1997). Loss of terminal sialic acid from mammalian glycans can increase binding of some proteins to exposed galactose or mannose residues, and increased expression of some uterine lectins have been demonstrated in early pregnancy (Gray et al. 2005). In the horse, various proteins in and around the early conceptus have been described in uterine fluid (Zavy et al. 1982, McDowell et al. 1990, Müller-Schöttle et al. 2002), the zona pellucida (Miller et al. 1992), the capsule (Stewart et al. 1995, Herrler & Beier 2000, Herrler et al. 2000b), and yolk-sac fluid (Crossett et al. 1996), but both the range of proteins characterized and definition of their developmental times of appearance and disappearance in the conceptus itself remain limited. To further investigate the role of the capsule in the success and failure of pregnancy in horses, we have started to identify proteins that are associated with the capsule and change during the process of fixation at about day 16. We have focused on major changes in the protein profiles within the capsule itself before and after fixation, and compared these profiles with those in contemporaneous uterine fluid (lavage), yolk-sac fluid, and yolk-sac wall tissues between days 13.5 and 26.5 of pregnancy. A preliminary account of some of these data has been reported previously (Quinn et al. 2005).
| Materials and Methods |
|---|
|
|
|---|
The conceptus was transferred to a Petri dish containing PBS where it was punctured after aspirating the PBS into a syringe and drying the dish with absorbent paper. The yolk-sac fluid released into the dry dish was collected by aspiration through a 20G needle. Puncturing the conceptus resulted in a split in the capsule through which yolk-sac wall (omphalopleure) tissues could be gently withdrawn after re-addition of PBS to the dish. After separation, the whole capsule and yolk-sac wall tissues were either stored frozen in PBS (capsule) or divided equally (tissues) for flash-freezing in liquid nitrogen or immersion in RNAlater before storage at –70 °C. The lavage and yolk-sac fluids were centrifuged to remove cells and particulates. Thirty-nine conceptuses and uterine samples were collected over one breeding season, ranging in age from 13.5 to 26.5 days. Additional conceptuses (n = 16) from previous breeding seasons ranging in age from 14 to 22 days were also examined.
A 100 ml aliquot of the uterine lavage fluid (1000 ml) was centrifuged to remove cells and particulates and then soluble proteins were concentrated 50 times, by centrifugal ultrafiltration at a 5 kDa cutoff (Amicon Ultra; Millipore Corporation, Bedford, MA, USA) before analysis. The yolk-sac fluids were similarly processed and concentrated 10 times. Uterine biopsies and yolk-sac wall tissues were homogenized in 0.5 ml PBS containing proteinase inhibitors (Complete Mini, Roche Diagnostics). Protein concentrations were determined by the Bio-Rad protein assay (Bradford 1976). The capsule was collected on a filter (Whatman 1; Fisher Scientific, Ottawa, ON, Canada) washed thrice in PBS and cut into sections for analysis. A section representing ~50% of the total capsule was boiled for 5 min in 100 µl 2 x SDS sample buffer (0.2 M Tris–HCl, pH 6.8 containing 2% SDS, 8% mercaptoethanol, and 24% glycerol), then diluted with 100 µl PBS. The capsule structure remained intact visually throughout the elution procedure.
Electrophoresis and protein identification
Proteins in samples were first characterized by 15% one-dimensional SDS–PAGE (with a 4% stacking region) in reducing conditions (Laemmli 1970) using the Bio-Rad modular Mini-Protean II system (Bio-Rad). Prestained broad range markers (Bio-Rad or New England Biolabs P7701S) were used to identify apparent molecular weights of isolated proteins. Electrophoresis was carried out at 4 °C for 1.5 h at 150 V.
The previously described equine uterine proteins p19/uterocalin (Stewart et al. 1995) and uteroglobin (Müller-Schöttle et al. 2002) were tentatively identified by their apparent molecular mass on SDS–PAGE and confirmed by immunoblots. Proteins were electrotransferred to a nitrocellulose membrane (Trans-Blot, Bio-Rad) in a 25 mM Tris–HCl buffer, containing 100 mM glycine and 20% methanol, at 4 °C for 1 h at 150 V, followed by 2 h at 100 V and were incubated overnight in PBS containing 1% BSA to block non-specific binding. Specific binding was detected by incubation with rabbit antiserum against recombinant equine p19/uterocalin from which the glutathione S-transferase fusion partner had been removed (Kennedy 2005) or rabbit anti-rat uteroglobin/Clara cell secretory protein (CCSP; generously provided by Drs Paula Katavolos and Dorothee Bienzle, University of Guelph). To identify immunoreactive MHC class 1 heavy chains, we used a mouse monoclonal IgG2a against horse MHC class 1 (Abcam, ab23491) followed by peroxidase-conjugated goat anti-mouse immunoglobulin G (IgG) H + L (Cedarlane, Hornby, ON, Canada). The major capsule bands identified as ß2 microglobulin (ß2M) were also detected by immunoblotting with primary rabbit anti-human ß2M antibody (Sigma). Immunoblots were washed twice for 15 min in PBS containing 0.01% Tween 20 (PBS/Tween) and incubated for 45 min in a 1:5000 diluted secondary antibody, peroxidase-labeled goat polyclonal anti-rabbit IgG H + L (Biomeda Corp., Foster City, CA, USA). All antibodies were diluted in PBS, 0.01% Tween 20 and 1% BSA. After washing four times for 15 min in PBS/Tween, the signal was revealed using a chemiluminescence substrate (ECL, Amersham Biosciences Inc.) following the manufacturers recommendations. Eluted capsule proteins, yolk-sac wall tissue, and endometrial homogenates were loaded at 10 µl/well and concentrated lavage and yolk-sac fluids were loaded at 20 µl/well for visualizing by silver staining (Oakley et al. 1980) and Western blot.
For N-terminal amino acid sequencing, proteins were loaded at 40 µl/well to 15% SDS–PAGE reduced gels, electrotransferred to PVDF membrane Immobilon-PSQ, Millipore Corporation) at 4 °C for 1 h at 150 V, followed by 2 h at 100 V in 25 mM Tris, 100 mM glycine, 20% methanol and stained with Coomassie G 250 stain (Bio-Rad). The bands of interest were cut from the membrane and analyzed (Biotechnology Laboratory, University of British Columbia, Canada).
For mass fingerprint analysis, proteins of interest were loaded at 40 µl/well to 15% SDS–PAGE reduced gels and the bands were excised and digested with trypsin. The gel slices were destained in 15 mM ferricyanide and 50 mM sodium thiosulfate for 20 min in the dark and washed with water until samples were clear. Gel slices were then dehydrated in 100% acetonitrile, dried in a vacuum centrifuge, reduced in 10 mM dithiothreitol in 100 mM NH4HCO3 at 50 °C for 30 min, followed by alkylation in 55 mM iodoacetamide in 100 mM NH4HCO3 for 60 °C min, at room temperature. Samples were then washed in 100 mM NH4HCO3, followed by a wash in 50 mM NH4HCO3 in 50% acetonitrile, then dehydrated in 100% acetonitrile and dried in a vacuum. Samples were rehydrated in digestion buffer containing 50 mM NH4HCO3 and 3 ng/µl of sequencing grade trypsin (Sigma) and incubated overnight at 37 °C. The digestion products were collected into a small volume of 2% trifluoracetic acid (TFA). Peptides were further extracted from the gel slices with two successive volumes of 0.1% TFA and 50% acetonitrile followed by one volume of 100% acetonitrile. The collected volumes were pooled and concentrated in a vacuum centrifuge. The peptide solutions were desalted using a C18 reverse phase chromatography matrix (ZipTipC18, Millipore) according to manufacturers recommended protocol. The peptide mass spectra were obtained by MALDI-TOF mass spectrometry with a Bruker reflex IV mass spectrometer (MALDI-TOF Mass Spectrometry Facility, Department of Molecular Biology and Genetics, University of Guelph). The NCBI non-redundant protein sequence database was searched initially using the MS Fit algorithm (Clauser et al. 1999) for proteins matching mass spectra within the taxonomic category Equus caballus. If no matches were found, further searches were performed to include all species.
Gene expression
Tissue expression of MHC class 1
chain and ß2M was detected qualitatively by RT-PCR using endometrial biopsies and yolk-sac wall tissues previously stored in RNAlater. Total RNA was isolated using TRIzol reagent (Ambion), based on the phenol–guanidine isothiocyanate protocol (Chomczynski & Sacchi 1987). cDNA was synthesized using the Thermoscript RT-PCR system according to manufacturers recommended protocol (Invitrogen) using oligo dT primers, an incubation step of 60 °C for 60 min and the optional RNase H step. cDNA amplification was performed using Platinum Taq DNA polymerase (Invitrogen) according to the manufacturers recommendations, with a primer concentration of 1 µM. Primers and conditions were designed following a previously described protocol (Bacon et al. 2002). For ß2M, a forward primer (5' GGTTCAGGTTTACTCACGTC 3') and a reverse primer (5' CACACCATTGGGAGTAAAGT 3') were used with amplification conditions of 94 °C (1 min), 50 °C (1 min), for 34 cycles and a final extension at 72 °C (10 min). For MHC class I, amplification conditions were as above, using a forward primer (5' CGTGCCGTGTGCAGC 3') and a reverse primer (5' GTGAACAAATCTCGCATC 3'). PCR products were electrophoresed on a 2% agarose gel and stained with ethidium bromide.
| Results |
|---|
|
|
|---|
|
|
|
chains (not shown), suggesting that ß2M in the capsule was not part of an MHC class 1 complex. Transcripts of equine ß2M (Fig. 8
|
|
|
|
|
|
|
|
-hemoglobin and ß-hemoglobin by MALDI mass spectra of their trypsin-digested peptides. Hemoglobins in the capsule increased after day 19 consistent with the development of the vasculature of the conceptus. In some mares, similar hemoglobin p13 and p14 bands were sporadically present in the uterine lavage fluids at earlier stages (Fig. 4| Discussion |
|---|
|
|
|---|
N9-ß2M lacking nine amino acids from the N-terminus) occurs at the stage around day 16 when the conceptus becomes fixed in the uterine lumen. The relatively large amounts of ß2M in the capsule but not in the uterine lavage suggest that some constituent of the capsule has the ability to preferentially bind both the intact and partially cleaved forms of ß2M. These observations raise the possibility that ß2M, without an associated MHC class 1 heavy chain, has a role in the capsule, either as the intact form before fixation, and/or as the cleaved form after fixation. However, it is equally possible that equine embryonic capsule has the unusual ability to bind ß2M, an ubiquitous protein, without any functional role therein.
The origin of the ß2M in the capsule could not be determined in our studies but since the capsule is acellular, it is most likely derived from the endometrium or yolk-sac wall tissues. We detected expression of ß2M in both by non-quantitative RT-PCR using primers described by others (Bacon et al. 2002). However, ß2M is expressed in most tissues from which it is continuously released as a small protein that is cleared by the kidney, and free ß2M has a tropism for some extracellular matrix substances, so the ß2M in the capsule might originate elsewhere. For example, ß2M without associated MHC class 1 heavy chains can be deposited in the connective tissue as amyloid in chronic renal disease (Monti et al. 2005, Myers et al. 2006). Intact and partially cleaved forms of ß2M can bind to connective tissue matrix components including collagen (Giorgetti et al. 2005) and glycosaminoglycans (Ohashi et al. 2002, Yamaguchi et al. 2003) in a manner that involves conformational changes induced by low pH (Monti et al. 2005) or copper ions (Villanueva et al. 2004, Deng et al. 2006). Limited proteolysis to the
N6-ß2M form of human ß2M alters binding in amyloid but is not required (Monti et al. 2005).
Sialic acid is removed from the capsule during fixation (Oriol et al. 1993a, 1993b, Chu et al. 1997) and the capsule is degraded within the following week. The N-terminal nine amino acid peptide is located on the surface of human ß2M in a position that might mask an internal functional site. Accordingly, proteolytic removal of the N-terminal fragment from ß2M in the capsule might be a necessary modification rather than a stage of capsule degradation. However, it is also plausible that equine monomeric ß2M initially binds to the capsule in a manner that limits its susceptibility to proteolysis. Experimental digestion of human monomeric ß2M with pepsin and other proteases yields various peptides but, under some conditions (e.g., pH 2.5), pepsin cleaves ß2M in a single location at valine nine (Myers et al. 2006). This cut yields a product (
N9-ß2M) that lacks nine amino acids from the N-terminus equivalent to the p8 form identified in the capsule in our studies. Such limited proteolysis has been explained on the basis of the limited access of proteases to ß2M embedded in connective tissue matrix or amyloid deposits (Monti et al. 2005). A similar explanation might apply to the degradation of ß2M in the capsule, because the 8 kDa form (
N9-ß2M) subsequently decreased in the capsule while there was an increase in a ~5 kDa band.
Intact monomeric ß2M might have an earlier role in the capsule before it is degraded. The terminal nine amino acid peptide is located on the surface of ß2M where it might provide a function to the capsule that is lost when ß2M is degraded. It appears that the N-terminal portion is not involved in binding to the capsule, since the
N9-ß2M form remains bound. Structural models of ß2M in association with MHC
-chains in hemochromatosis factor (HFE; Lebron et al. 1998), MHC-1 (Reiser et al. 2000), and immunoglobulin transporter Fc
-receptor (Martin et al. 2001) all indicate that the nine N-terminal amino acids of ß2M and the underlying polypeptide are located away from the surfaces that associate with the MHC-1 heavy chain partners.
Known functions of ß2M during early pregnancy are those of various MHC class 1 complexes in which ß2M is the light chain complexed non-covalently with a heavy
-chain of ~43 kDa. However, the relative abundance of ß2M in the capsule without an equivalent amount of a MHC class 1
-chain partner suggests that ß2M might have some other role independent of those of the MHC class 1 proteins. The horse ß2M gene is highly conserved among equids which has regulatory regions similar to those in the human and murine ß2M genes and it is usually co-expressed with various MHC class 1
-chains (Tallmadge et al. 2003). During in utero development in mammals, ß2M can be co-expressed with various MHC class 1
heavy chain partners. These include the classical polymorphic MHC class 1 antigen presentation complex (Leitner et al. 2002), the non-classical MHC class 1 proteins implicated in blocking NK-cell-mediated rejection of the trophoblast (Morales et al. 2003, Hunt et al. 2005), the iron uptake protein HFE (Gruper et al. 2005), and the class of Fc receptors involved in placental or enteric transport of immunoglobulins or the recycling of albumin (Ellinger et al. 2005). Between days 14 and 20 of pregnancy in sheep, endometrial expression of ß2M is induced under the influence of maternal progesterone and interferon tau from the conceptus but the ß2M and MHC-1 proteins are expressed mainly in the uterine glands and stroma away from the conceptus (Choi et al. 2003, Gray et al. 2006). Expression of classical highly polymorphic antigen-presenting MHC class 1 proteins is typically reduced in embryonic tissues in mammals, including horses, to shield the paternally derived antigens from the maternal immune system (Bacon et al. 2002). However, classical and non-classical MHC class 1
-chains and ß2M are focally induced between days 30 and 36 in the invasive chorionic girdle region of the equine trophoblast (Kydd et al. 1991, Vagnoni et al. 1996a, 1996b, Bacon et al. 2002, Tallmadge et al. 2005). MHC-class 1
-chain genes expressed in invasive human trophoblast are mainly the non-classical HLA-C, -E and G class involved in regulating NK-cell responses involved in implantation and placentation (Morales et al. 2003, Hunt et al. 2005, Trowsdale & Betz 2006). All of the expressed MHC class 1
-chain genes in the cluster on chromosome 20q21 have membrane-binding domains (Tallmadge et al. 2005). However, some forms of human HLA-G that associate with ß2M, are soluble and lack the membrane association domain (Hunt et al. 2005). Expressed soluble MHC class 1 complexes (ESC1) analogous to the Q10 molecule, which is expressed in the liver and yolk sac of the mouse, have been reported in the serum of horses (Lew et al. 1986).
Other major proteins present during the encapsulation phase such as p19/uterocalin and uteroglobin in the uterus, and the GM2AP in the trophoblast (Quinn et al. 2006) are lipid-binding proteins with transport roles that are likely necessary for the uptake of lipids through the hydrophilic capsule glycan. A lipid provisioning role has been proposed for p19/uterocalin that is secreted in abundance under the influence of progesterone, and that is transferred into the yolk sac of encapsulated embryos (Suire et al. 2001, Kennedy 2005). P19/uterocalin was first identified in the capsule (Stewart et al. 1995), but whether it is there in large amounts as it is bound or in transit is still unclear. We observed that p19/uterocalin was present in consistent amounts both in the capsule and in the uterine lavage fluids throughout the fixation period. By comparison, amounts of p19/uterocalin in the yolk-sac fluid were greatest before fixation, while ß2M was the most abundant protein in the capsule. This suggests that either the entry of p19/uterocalin into the yolk-sac fluid is transient until fixation or that it does not accumulate later because it is catabolized. A similar situation was noted for uteroglobin that was always plentiful in the uterine lavage fluids but present in the yolk-sac fluid only before fixation. Uteroglobin/CCSP has a phospholipid-binding pocket (Beier 2000, von der Decken et al. 2005) and it may also serve some role in the delivery of lipid ligands through the capsular glycan in the horse. Uteroglobin is a progesterone-dependent uterine secretory protein in various mammals including those in which the conceptus is not encapsulated (Beier 2000), and the abundant uteroglobin did not bind to the capsule. By comparison, p19/uterocalin has not been demonstrated in non-equids and its presence in the yolk sac declines as the capsule is degraded.
| Acknowledgements |
|---|
|
|
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Amoroso EC 1952 In Marshalls Physiology of Reproduction, pp 127–311. Ed. AC Parkes. London: Longmans Green.
Bacon SJ, Ellis SA & Antczak DF 2002 Control of expression of major histocompatibility complex genes in horse trophoblast. Biology of Reproduction 66 1612–1620.
Baker CB, Little TV & McDowell KJ 1993 The live foaling rate per cycle in mares. Equine Veterinary Journal 15 28–30.
Ball BA 1988 Embryonic loss in mares: incidence, possible causes and diagnostic considerations. Veterinary Clinics of North America Equine Practice 4 263–290.[Web of Science]
Beier HM 2000 The discovery of uteroglobin and its significance for reproductive biology and endocrinology. Annals of the New York Academy of Science 923 9–24.[Web of Science][Medline]
Beier-Hellwig K, Kremer H, Bonn B, Lindner D & Beier HM 1995 Partial sequencing and identification of three proteins from equine uterine secretion regulated by progesterone. Reproduction in Domestic Animals 30 295–298.[Web of Science]
Betteridge KJ 1989 The structure and function of the equine capsule in relation to embryo manipulation and transfer. Equine Veterinary Journal 8 92–100.
Betteridge KJ & Waelchli RO 2005 Equine embryo encapsulation; ephemeral, essential and enigmatic. Havemeyer Foundation Monograph Series 16 59–61.
Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Analytical Biochemistry 72 248–254.[CrossRef][Web of Science][Medline]
Carnevale EM, Ramirez RJ, Squires EL, Alvarenga MA, Vanderwall DK & McCue PM 2000 Factors affecting pregnancy rates and early embryonic death after equine embryo transfer. Theriogenology 54 965–979.[CrossRef][Web of Science][Medline]
Choi Y, Johnson GA, Spencer TE & Bazer FW 2003 Pregnancy and interferon tau regulate major histocompatibility complex class I and beta2-microglobulin expression in the ovine uterus. Biology of Reproduction 68 1703–1710.
Chomczynski P & Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Analytical Biochemistry 162 156–159.[Web of Science][Medline]
Chu JW, Sharom FJ, Oriol JG, Betteridge KJ, Cleaver BD & Sharp DC 1997 Biochemical changes in the equine capsule following prostaglandin-induced pregnancy failure. Molecular Reproduction and Development 46 286–295.[CrossRef][Web of Science][Medline]
Clauser KR, Baker P & Burlingame AL 1999 Role of accurate mass measurement (+/– 10 ppm) in protein identification strategies employing MS or MS/MS and database searching. Analytical Chemistry 71 2871–2882.[Medline]
Crossett B, Allen WR & Stewart F 1996 A 19 kDa protein secreted by the endometrium of the mare is a novel member of the lipocalin family. Biochemical Journal 320 137–143.[Web of Science][Medline]
Crossett B, Suire S, Herrler A, Allen WR & Stewart F 1998 Transfer of a uterine lipocalin from the endometrium of the mare to the developing equine conceptus. Biology of Reproduction 59 483–490.
von der Decken V, Delbruck H, Herrler A, Beier HM, Fischer R & Hoffmann KM 2005 Recombinant bovine uteroglobin at 1.6 A resolution: a preliminary X-ray crystallographic analysis. Acta Crystallographica. Section F, Structural Biology and Crystallization Communications 61 499–502.[CrossRef][Web of Science]
Deng NJ, Yan L, Singh D & Cieplak P 2006 Molecular basis for the Cu2+ binding-induced destabilization of ß2-microglobulin revealed by molecular dynamics simulation. Biophysical Journal 90 3865–3879.[CrossRef][Web of Science][Medline]
Ellinger I, Reischer H, Lehner C, Leitner K, Hunziker W & Fuchs R 2005 Overexpression of the human neonatal Fc-receptor alpha-chain in trophoblast-derived BeWo cells increases cellular retention of beta2-microglobulin. Placenta 26 171–182.[CrossRef][Web of Science][Medline]
Ellis SA & Martin AJ 1993 Nucleotide sequence of horse beta 2-microglobulin cDNA. Immunogenetics 38 383.[Web of Science][Medline]
Ewart JC 1915 Studies of the development of the horse. I. The development during the third week. Transactions of the Royal Society of Edinburgh 51 287–329.
Ginther OJ 1983 Fixation and orientation of the early equine conceptus. Theriogenology 19 613–623.[CrossRef][Web of Science][Medline]
Ginther OJ 1985 Dynamic physical interactions between the equine embryo and uterus. Equine Veterinary Journal Supplement 3 41–47.
Giorgetti S, Rossi A, Mangione P, Raimondi S, Marini S, Stoppini M, Corazza A, Viglino P, Esposito G, Cetta G et al. 2005 Beta2-microglobulin isoforms display an heterogeneous affinity for type I collagen. Protein Science 14 696–702.[CrossRef][Web of Science][Medline]
Gray CA, Dunlap KA, Burghardt RC & Spencer TE 2005 Galectin-15 in ovine uteroplacental tissues. Reproduction 130 231–240.
Gray CA, Abbey CA, Beremand PD, Choi Y, Farmer JL, Adelson DL, Thomas TL, Bazer FW & Spencer TE 2006 Identification of endometrial genes regulated by early pregnancy, progesterone, and interferon tau in the ovine uterus. Biology of Reproduction 74 383–394.
Gruper Y, Bar J, Bacharach E & Ehrlich R 2005 Transferrin receptor co-localizes and interacts with the hemochromatosis factor (HFE) and the divalent metal transporter-1 (DMT1) in trophoblast cells. Journal of Cell Physiology 204 901–912.[CrossRef][Web of Science][Medline]
Harvey W 1847 De Generatione Animalium (1651). In The Works of William Harvey, Ed. R Willis. London: Sydenham Society.
Herrler A & Beier HM 2000 Early embryonic coats: morphology, function, practical applications. An overview. Cells Tissues Organs 166 233–246.[CrossRef][Web of Science][Medline]
Herrler A, Stewart F, Crossett B, Pell J, Ellis P, Brown K, Beier H & Allen W 1998 Embryonic coats – a mailbox in early embryo–maternal signalling. Journal of Reproduction and Fertility Abstract Series 21 22.
Herrler A, Pell JM, Allen WR, Beier HM & Stewart F 2000a Horse conceptuses secrete insulin-like growth factor-binding protein 3. Biology of Reproduction 62 1804–1811.
Herrler A, Stewart F, Crossett B, Pell J, Ellis P, Beier H & Allen W 2000b Identification of proteins in the embryonic capsule. Journal of Reproduction and Fertility Supplement 56 601–606.
Hunt JS, Petroff MG, McIntire RH & Ober C 2005 HLA-G and immune tolerance in pregnancy. FASEB Journal 19 681–693.
Kennedy MW 2005 Uterocalin – provider of essential lipids and amino acids to the pre-placentation equine conceptus. Havemeyer Foundation Monograph Series 16 53–56.
Kenney RM 1975 Prognostic value of endometrial biopsy in the mare. Journal of Reproduction and Fertility Supplement 23 347–348.
Kydd JH, Butcher GW, Antczak DF & Allen WR 1991 Expression of major histocompatibility complex (MHC) class 1 molecules on early trophoblast. Journal of Reproduction and Fertility Supplement 44 463–477.
Laemmli UK 1970 Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 680–685.[CrossRef][Medline]
Lebron JA, Bennett MJ, Vaughn DE, Chirino AJ, Snow PM, Mintier GA, Feder JN & Bjorkman PJ 1998 Crystal structure of the hemochromatosis protein HFE and characterization of its interaction with transferrin receptor. Cell 93 111–123.[CrossRef][Web of Science][Medline]
Leitner K, Ellinger A, Zimmer KP, Ellinger I & Fuchs R 2002 Localization of beta 2-microglobulin in the term villous syncytiotrophoblast. Histochemistry and Cell Biology 117 187–193.[CrossRef][Web of Science][Medline]
Lew AM, Valas RB, Maloy WL & Coligan JE 1986 A soluble class I molecule analogous to mouse Q10 in the horse and related species. Immunogenetics 23 277–283.[CrossRef][Web of Science][Medline]
Marrable AW & Flood PF 1975 Embryological studies on the dartmoor pony during the first third of gestation. Journal of Reproduction and Fertility Supplement 23 499–502.
Marshall FHA 1910 The Physiology of Reproduction, 1st edn. London: Longmans Green and Co.
Martin WL, West AP Jr, Gan L & Bjorkman PJ 2001 Crystal structure at 2.8 A of an FcRn/heterodimeric Fc complex: mechanism of pH-dependent binding. Molecular Cell 7 867–877.[CrossRef][Web of Science][Medline]
McDowell KJ, Sharp DC, Grubaugh W, Thatcher WW & Wilcox CJ 1988 Restricted conceptus mobility results in failure of pregnancy maintenance in mares. Biology of Reproduction 39 340–348.[Abstract]
McDowell KJ, Sharp DC, Fazleabas AT & Roberts RM 1990 Two-dimensional polyacrylamide gel electrophoresis of proteins synthesized and released by conceptuses and endometria from pony mares. Journal of Reproduction and Fertility 89 107–115.
Miller CC, Fayrer-Hosken RA, Timmons TM, Lee VH, Caudle AB & Dunbar BS 1992 Characterization of equine zona pellucida glycoproteins by polyacrylamide gel electrophoresis and immunological techniques. Journal of Reproduction and Fertility 96 815–825.
Monti M, Amoresano A, Giorgetti S, Bellotti V & Pucci P 2005 Limited proteolysis in the investigation of beta2-microglobulin amyloidogenic and fibrillar states. Biochimica Biophysica Acta 1753 44–50.[Medline]
Morales PJ, Pace JL, Platt JS, Phillips TA, Morgan K, Fazleabas AT & Hunt JS 2003 Placental cell expression of HLA-G2 isoforms is limited to the invasive trophoblast phenotype. Journal of Immunology 171 6215–6224.
Morris LH & Allen WR 2002 Reproductive efficiency of intensively managed Thoroughbred mares in Newmarket. Equine Veterinary Journal 34 51–60.[CrossRef][Web of Science][Medline]
Müller-Schöttle F, Bogusz A, Grotzinger J, Herrler A, Krusche CA, Beier-Hellwig K & Beier HM 2002 Full-length complementary DNA and the derived amino acid sequence of horse uteroglobin. Biology of Reproduction 66 1723–1728.
Myers SL, Thomson NH, Radford SE & Ashcroft AE 2006 Investigating the structural properties of amyloid-like fibrils formed in vitro from beta(2)-microglobulin using limited proteolysis and electrospray ionisation mass spectrometry. Rapid Communications in Mass Spectrometry 20 1628–1636.[CrossRef][Web of Science][Medline]
Needham W 1667 Disquisitio Anatomica de Formato Foetu, London: William Godbid.
Oakley BR, Kirsch DR & Morris NR 1980 A simplified ultrasensitive silver stain for detecting proteins in polyacrylamide gels. Analytical Biochemistry 105 361–363.[CrossRef][Web of Science][Medline]
Ohashi K, Kisilevsky R & Yanagishita M 2002 Affinity binding of glycosaminoglycans with ß2-microglobulin. Nephron 90 158–168.[CrossRef][Web of Science][Medline]
Oriol JG, Sharom FJ & Betteridge KJ 1993a Developmentally regulated changes in the glycoproteins of the equine embryonic capsule. Journal of Reproduction and Fertility 99 653–664.
Oriol JG, Betteridge KJ, Clarke AJ & Sharom FJ 1993b Mucin-like glycoproteins in the equine embryonic capsule. Molecular Reproduction and Development 34 255–265.[CrossRef][Web of Science][Medline]
Quinn BA, Hayes MA, Betteridge KJ & Waelchli RO 2005 Major proteins in the embryonic capsule, and in yolk-sac and uterine fluids, during the second to fourth weeks of pregnancy in the mare. Havemeyer Foundation Monograph Series 16 47–49.
Quinn BA, Caswell DE, Lillie BN, Waelchli RO, Betteridge KJ & Hayes MA 2006 The GM2-activator protein is a major protein expressed by the encapsulated equine trophoblast. Animal Reproduction Science 94 391–394.[CrossRef][Web of Science]
Reiser JB, Darnault C, Guimezanes A, Gregoire C, Mosser T, Schmitt-Verhulst AM, Fontecilla-Camps JC, Malissen B, Housset D & Mazza G 2000 Crystal structure of a T cell receptor bound to an allogeneic MHC molecule. Nature Immunology 1 291–297.[CrossRef][Web of Science][Medline]
Stewart F, Charleston B, Crossett B, Barker PJ & Allen WR 1995 A novel uterine protein that associates with the embryonic capsule in equids. Journal of Reproduction and Fertility 105 65–70.
Stewart F, Kennedy MW & Suire S 2000 A novel uterine lipocalin supporting pregnancy in equids. Cellular and Molecular Life Sciences 57 1373–1378.[CrossRef][Web of Science][Medline]
Stout TA, Meadows S & Allen WR 2005 Stage-specific formation of the equine blastocyst capsule is instrumental to hatching and to embryonic survival in vivo. Animal Reproduction Science 87 269–281.[CrossRef][Web of Science][Medline]
Suire S, Stewart F, Beauchamp J & Kennedy MW 2001 Uterocalin, a lipocalin provisioning the preattachment equine conceptus: fatty acid and retinol binding properties, and structural characterization. Biochemical Journal 356 369–376.[CrossRef][Web of Science][Medline]
Tallmadge RL, Lear TL, Johnson AK, Guerin G, Millon LV, Carpenter SL & Antczak DF 2003 Characterization of the ß2-microglobulin gene of the horse. Immunogenetics 54 725–733.[Web of Science][Medline]
Tallmadge RL, Lear TL & Antczak DF 2005 Genomic characterization of MHC class I genes of the horse. Immunogenetics 57 763–774.[CrossRef][Web of Science][Medline]
Trowsdale J & Betz AG 2006 Mothers little helpers: mechanisms of maternal–fetal tolerance. Nature Immunology 7 241–246.[CrossRef][Web of Science][Medline]
Vagnoni KE, Ginther OJ & Lunn DP 1996a Expression of major histocompatibility complex antigen and timing of invasion by equine chorionic girdle cells cultured on Matrigel. Biology of Reproduction 54 219–223.[Abstract]
Vagnoni KE, Schram BR, Ginther OJ & Lunn DP 1996b Susceptibility of equine chorionic girdle cells to lymphokine-activated killer cell activity. American Journal of Reproductive Immunology 36 184–190.
Villanueva J, Hoshino M, Katou H, Kardos J, Hasegawa K, Naiki H & Goto Y 2004 Increase in the conformational flexibility of beta 2-microglobulin upon copper binding: a possible role for copper in dialysis-related amyloidosis. Protein Science 13 797–809.[CrossRef][Web of Science][Medline]
Waelchli RO & Betteridge KJ 1996 Osmolality of equine blastocyst fluid from day 11 to day 25 of pregnancy. Reproduction Fertility and Development 8 981–988.[CrossRef][Medline]
Yamaguchi I, Suda H, Tsuzuike N, Seto K, Seki M, Yamaguchi Y, Hasegawa K, Takahashi N, Yamamoto S, Gejyo F et al. 2003 Glycosaminoglycan and proteoglycan inhibit the depolymerization of beta2-microglobulin amyloid fibrils in vitro. Kidney International 64 1080–1088.[CrossRef][Web of Science][Medline]
Zavy MT, Sharp DC, Bazer FW, Fazleabas A, Sessions F & Roberts RM 1982 Identification of stage-specific and hormonally induced polypeptides in the uterine protein secretions of the mare during the oestrous cycle and pregnancy. Journal of Reproduction and Fertility 64 199–207.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |