| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
RESEARCH |
1 The ARC Centre of Excellence in Biotechnology and Development, 2 Murdoch Childrens Research Institute and the Department of Paediatrics, University of Melbourne, Royal Childrens Hospital, Melbourne, Victoria, Australia and 3 Monash Institute of Medical Research, Monash University, Clayton, Victoria, Australia
Correspondence should be addressed to A H Sinclair, Murdoch Childrens Research Institute, Royal Childrens Hospital, Melbourne, Victoria 3052, Australia; Email: andrew.sinclair{at}mcri.edu.au
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Wsb2 was previously detected by northern analysis in most adult mouse tissues and also during embryogenesis between 9 dpc and 18 dpc (Hilton et al. 1998). The present study describes a detailed analysis of the expression pattern of Wsb2 during mouse gonadogenesis.
| Materials and Methods |
|---|
|
|
|---|
The embryos were dissected from pregnant mice in ice-cold DEPCPBS (diethyl pyrocarbonatephosphate buffer solution). Heads, torsos and viscera overlying the urogenital systems (gonads, mesonephros, Müllerian and Wolffian ducts) were removed and the embryos containing the urogenital system were processed. Embryos were fixed in 4% paraformaldehyde (PFA) for whole-mount in situ hybridisation (WISH) analysis or fixed in Bouins for section in situ hybridisation. For RT-PCR, gonads were dissected free from the mesonephros, frozen immediately on dry-ice and stored at 80 °C until RNA extraction. For immunofluorescence, embryos were fixed in 4% PFA, left overnight in 20% sucrose at 4 °C, embedded in OCT (Tissue TeK, USA) and snap frozen in isopentane/liquid nitrogen.
Busulfan was administered in vivo to deplete developing embryos of germ cells as described (McClive et al. 2003). Briefly, 9.5 dpc pregnant mother mice were injected intraperitoneally with busulfan (40 mg/kg; Sigma) in dimethyl sulphoxide (50% DMSO; Sigma) and mouse embryos were dissected at 13.5 dpc, as previously described for WISH.
Adult mouse seminiferous tubule culture
Dissected adult mouse testes were decapsulated and placed in Dulbeccos minimal eagle medium (DMEM). Tubules were dissociated using fine forceps and cut into 25 mm fragments. Up to five tubule fragments were cultured in 30 µl hanging drops in DMEM and 0.1% BSA at 32 °C for 48 h with 5% CO2/95% air. Cyclopamine (final concentration 100 µM; Calbiochem, Kilsyth, Victoria, Australia) was added to the culture medium to inhibit Hedgehog signalling (Chen et al. 2002). An equivalent volume of ethanol (the solvent for cyclopamine) was added to control samples. After culture, the tubules were collected and stored at 80 °C prior to RNA extraction. All experiments were performed for a minimum of three times.
Section in situ hybridisation (ISH) and WISH
The Wsb2 clone isolated during the differential screen described by McClive et al.(2003) was used as a template for production of antisense and sense riboprobes. This fragment comprised 610 bp mouse clone AF072881
[GenBank]
. Whole-mount in situ hybridisation was carried out as previously described on PFA-fixed embryos (Andrews et al. 1997). A minimum of two embryos per sex were sampled in at least two independent experiments.
Section ISH using digoxigenin-labelled cRNAs was used to localise Wsb2 mRNAs in 4 µm sections of Bouins fixed, paraffin-embedded mouse tissue using procedures previously described, with hybridisation and washing temperatures up to 50 °C (Meinhardt et al. 1998). Both antisense and sense (negative control) cRNAs were used on each sample in every experiment. A minimum of two independent sections were assessed in at least two independent experiments.
RT-PCR and real-time PCR
Three pools of seven to ten pairs of gonads of each sex were collected and total RNA was isolated using the Qiagen RNA isolation kit (Qiagen), from embryos at 12.5, 14.5, 16.5 dpc and 0 dpp (day of birth). RNA was treated with DNase I (IU/1 mg RNA) for 30 min at 37 °C, and the enzyme inactivated by heating to 70 °C for 5 min. DNase I-treated total RNA samples (500 ng) were then transcribed using Superscript II reverse transcriptase and a mixture of oligo d(T)20 and random hexamer primers as previously described (Sarraj et al. 2005). RNA was quantified using the Quant-iT RiboGreen RNA Assay Kit (Molecular Probes, Invitrogen). For RT-PCR, samples were processed as described by Sarraj et al.(2005). For real-time PCR, samples were prepared in a final volume of 10 µl using either Roche Diagnostics SYBR-Green PCR master mix or the Applied Biosystems (ABI, Scorsby, Victoria, Australia) SYBR-Green PCR master mix, 300 nM forward and reverse primers. PCR was performed either on the Light Cycler 2.0 Instrument (Roche Molecular Biochemicals) or on the 7900 Applied Biosystem Fast real-time machine using the following thermocycler conditions: stage 1, 50 °C for 2 min, 1 cycle; stage 2, 95 °C for 10 min, 1 cycle; stage 3, 95 °C for 15 s and 55 °C for 1 min, 40 cycles. Melting curve analysis and agarose gel electrophoresis were used to monitor production of the appropriate PCR product.
Each PCR was performed in triplicate with negative controls, where water was used in place of the reverse-transcribed template included for each primer pair, to visualise PCR amplification of any contaminating DNA. The amount of 18S mRNA was measured in each sample template to normalise between samples (18S, forward: 5' gtaacccgttgaaccccatt 3'; 18S, reverse: 5' ccatccaatcgg-tagtagcg 3' from accession number: NM_003278 [GenBank] ). For RT-PCR, ß-actin primers used were as follows: ß-actin forward: 5' aggctgtgctgtccctgtat 3' and ß-actin reverse 5' aaggaaggctggaaaagagc 3' from accession number (AK075973 [GenBank] ). Wsb2 primers used were: Wsb2 forward: 5' gtaagcagatccaggtgttatccg 3' and Wsb2 reverse: 5' ccagatcctgagcagcctgt 3'. Wsb2 primers amplified a product of 401 bp. Gli1 primers used were: Gli1 forward: 5' ggaagtcctattcacgccttga 3' and Gli1 reverse: 5' caaccttcttgctcacacatgta 3'. These primers amplified a product of 88 bp from accession number (NM_010296 [GenBank] ; Doles et al. 2006). All products were verified by subcloning and sequencing.
To correlate the cycle threshold (Ct) values from the sample amplification plot to target copy number, a standard curve was produced for each target using adult mouse testis cDNA containing a starting material of 500 ng RNA. To control for overall gene expression, the average Ct for 18S was subtracted from the average Ct value for Wsb2 to generate the
Ct for each sample. Fold change was calculated as 2 to the 
Ct power (2
Ct) as previously described by Yao et al.(2006). Statistical analysis was performed using Students unpaired t-test or one-way ANOVA (P<0.01 is considered significant) to analyse statistical differences between samples. The data were calculated as the percentage mean ± S.E.M. The experiment was performed three times and each sample was done in triplicate.
Immunohistochemistry and immunofluorescence
Wsb2 antibody was kindly provided by Doug Hilton (Walter Eliza Hall Institute, Melbourne, Victoria, Australia) and was purified from crude rabbit antiserum using Protein A Sepharose according to the manufacturers instructions (Bio-Rad) using a column connected to a Bio-Rad Econo pump. Individual fractions were analysed by SDS-PAGE to determine purity. Anti-Wsb2 was used at 1:2000 dilution (0.2 mg/ml) in Tris-buffered saline (TBS)/0.1% BSA/PBS. For immunohistochemistry, binding was detected using a biotin-labelled goat anti-rabbit IgG secondary (DAKO, Botany, Australia) applied to sections at the ratio of 1:500. For immunofluorescence, binding was detected using green-fluorescent Alexa Fluor 488 goat anti-rabbit IgG secondary (Molecular Probes, Invitrogen) applied to sections at the ratio of 1:200 in TBS/0.1% BSA/PBS.
Tissue was fixed in Bouins fixative for 5 h, dehydrated in ethanol and embedded in paraffin. Sections (4 µm) were deparaffinised two times for 5 min each and rehydrated in an ethanol gradient (100% (two times), 95 and 70%) for 5-min cycles. Slides were then treated with 3% hydrogen peroxide to quench endogenous peroxidases. For immunofluorescence, the cycle times were extended to 20 min for deparaffinising and 15 min for ethanol washes and no hydrogen peroxide was used. Antigen retrieval was performed in 50 mM glycine (pH 3.5; for 10 min at >90 °C) and slides were left to cool for 20 min before proceeding. Slides were incubated for 20 min with 10% normal serum (of the species in which the secondary antibody was raised) in TBS. Slides were rinsed with TBS (two times for 5 min each) between incubations. The primary antibody was applied at (1:2000 dilution) for overnight incubation in TBS/0.1% BSA/PBS. The primary antibody binding was detected using the secondary antibody to sections, for 1 h at room temperature. Following application of the secondary antibody, sections were washed with TBS (two times for 5 min each). For immunohistochemistry, the Vectastain Elite ABC kit was used according to manufacturers instructions (Vector Laboratories, Burlingame, CA, USA). Antibody binding was detected as a brown precipitate following development with 3,3-diaminobenzidine tetrahydrochloride, and Harris Hematoxylin was used as a counterstain. The sections were mounted under glass 22x55 mm coverslips (HD Scientific, Bayswater, Victoria, Australia) in Depex (BDH Laboratories, Poole, UK). For immunofluorescence, following secondary detection, sections were washed with TBS (two times for 5 min each) and mounted with FluorSave (Calbiochem) under glass coverslips.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
Section in situ hybridisation and immunohistochemistry indicated the presence of Wsb2 mRNA and protein within the cytoplasm of Sertoli cell, gonocytes and interstitial cells at the day of birth (0 dpp; Fig. 7A and E
). At 15 dpp, signal was detected in Sertoli cells and germ cells, including spermatogonia and spermatocytes (Fig. 7C and G
).
|
|
|
|
| Discussion |
|---|
|
|
|---|
The present study demonstrates that Wsb2 is expressed in the developing male mouse gonads at 11.5 dpc, when the mRNA levels are roughly equivalent in both sexes. The signal is present in both sexes from 11.5 dpc until 12.0 dpc. The signal increases with age in the male gonads, while in the female gonad, a threefold increase was seen between 12.5 and 14.5 dpc followed by the downregulation in mRNA levels from 14.5 dpc and until the day of birth. At birth, a significant sevenfold higher level of Wsb2 RNA was detected in the testis when compared with that in the ovary. Wsb2 mRNA and its protein were detected in Sertoli, interstitial and germ cells throughout testis development.
Wsb2 contains WD repeats, highly conserved amino acid sequences found in a wide variety of cytoplasmic proteins many of which are involved in signal transduction or cell regulatory functions (Neer et al. 1994). Wsb2 also contains a SOCS box, a feature of other SOCS proteins involved in cytokine signalling and intracellular signal transduction. Although not much is known about the WSB family in testis development, WSB has been shown to be involved in Hedgehog signalling during limb and neural development. The Hedgehog pathway is also critical for foetal gonad development. Hedgehog signalling in the mammalian testis is involved in communicating between Sertoli and Leydig cells, germ cells (Kroft et al. 2001) and peritubular cells (Clark et al. 2000). The Hedgehog family member desert Hedgehog (Dhh) was found to be expressed in Sertoli cell precursors shortly after the activation of Sry and persists in these cells into adulthood (Bitgood et al. 1996, Szczepny et al. 2006). Male mice with a Dhh null mutation are sterile and exhibit a block in germ cell maturation at the pachytene primary spermatocyte stage (Kroft et al. 2001). Adult mouse testis tubules cultured in vitro for 48 h in the presence of the specific Hedgehog signalling inhibitor, cyclopamine, exhibited down-regulation of mRNA expression of Wsb2. The decrease in Wsb2 mRNA levels after Hedgehog inhibition indicates that Wsb2 is downstream of Dhh in the signalling pathway, however, further studies would be required to establish its nature. The structure and expression pattern of Wsb2 suggest that it may have roles in cellcell interactions in embryonic gonad development and later in spermatogenesis. The presence of Wsb2 in the adult female ovarian follicles and in theca cells suggests that it may also be participating in the communication between granulosa and developing theca cells. A recent study showed the mammalian ovary to be a site of active Hedgehog signalling (Wijgerde et al. 2005), and further study will provide an insight on whether Wsb2 participates in this signalling.
| Acknowledgements |
|---|
|
|
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Andrews JE, Smith CA & Sinclair AH 1997 Sites of estrogen receptor and aromatase expression in the chicken embryo. General and Comparative Endocrinology 108 182190.[CrossRef][Web of Science][Medline]
Bitgood MJ, Shen L & McMahon AP 1996 Sertoli cell signaling by Desert hedgehog regulates the male germline. Current Biology 6 298304.[CrossRef][Web of Science][Medline]
Chen JK, Taipale J, Cooper MK & Beachy PA 2002 Inhibition of Hedgehog signaling by direct binding of cyclopamine to Smoothened. Genes and Development 16 27432748.
Clark AM, Garland KK & Russell LD 2000 Desert hedgehog (Dhh) gene is required in the mouse testis for formation of adult-type Leydig cells and normal development of peritubular cells and seminiferous tubules. Biology of Reproduction 63 18251838.
Doles J, Cook C, Shi X, Valosky J, Lipinski R & Bushman W 2006 Functional compensation in Hedgehog signaling during mouse prostate development. Developmental Biology 295 1325.[CrossRef][Web of Science][Medline]
Hilton DJ, Richardson RT, Alexander WS, Viney EM, Willson TA, Sprigg NS, Starr R, Nicholson SE, Metcalf D & Nicola NA 1998 Twenty proteins containing a C-terminal SOCS box form five structural classes. PNAS 95 114119.
Kroft TL, Patterson J, Won Yoon J, Doglio L, Walterhouse DO, Iannaccone PM & Goldberg E 2001 GLI1 localization in the germinal epithelial cells alternates between cytoplasm and nucleus: upregulation in transgenic mice blocks spermatogenesis in pachytene. Biology of Reproduction 65 16631671.
McClive PJ, Hurley TM, Sarraj MA, van den Bergen JA & Sinclair AH 2003 Subtractive hybridisation screen identifies sexually dimorphic gene expression in the embryonic mouse gonad. Genesis 37 8490.[CrossRef][Web of Science][Medline]
Meinhardt A, OBryan MK, McFarlane JR, Loveland KL, Mallidis C, Foulds LM, Phillips DJ & de Kretser DM 1998 Localization of follistatin in the rat testis. Journal of Reproduction and Fertility 112 233241.
Neer EJ, Schmidt CJ, Nambudripad R & Smith TF 1994 The ancient regulatory-protein family of WD-repeat proteins. Nature 371 297300.[CrossRef][Medline]
Russell LD, Ettlin RA, Hikim APS & Clegg ED 1990 Histological and histopathological evaluation of the testis, Clearwater, FL, USA: Cache River Press.
Sarraj MA, McClive PJ, Wilmore HP, Loveland KL & Sinclair AH 2005 Novel scavenger receptor gene is differentially expressed in the embryonic and adult mouse testis. Developmental Dynamics 234 10261033.[CrossRef][Web of Science][Medline]
Sinclair AH, Berta P, Palmer MS, Hawkins JR, Griffiths BL, Smith MJ, Foster JW, Frischauf AM, Lovell-Badge R & Goodfellow PN 1990 A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346 240244.[CrossRef][Medline]
Szczepny A, Hime GR & Loveland KL 2006 Expression of hedgehog signalling components in adult mouse testis. Developmental Dynamics 235 30633070.[CrossRef][Web of Science][Medline]
Vasiliauskas D, Hancock S & Stern CD 1999 SWiP-1: novel SOCS box containing WD-protein regulated by signalling centres and by Shh during development. Mechanisms of Development 82 7994.[CrossRef][Web of Science][Medline]
Wijgerde M, Ooms M, Hoogerbrugge JW & Grootegoed JA 2005 Hedgehog signaling in mouse ovary: Indian hedgehog and desert hedgehog from granulosa cells induce target gene expression in developing theca cells. Endocrinology 146 35583566.[CrossRef][Web of Science][Medline]
Yao HH, Aardema J & Holthusen K 2006 Sexually dimorphic regulation of inhibin beta B in establishing gonadal vasculature in mice. Biology of Reproduction 74 978983.
This article has been cited by other articles:
![]() |
M. A. Sarraj, R. M. Escalona, A. Umbers, H. K. Chua, C. Small, M. Griswold, K. Loveland, J. K. Findlay, and K. L. Stenvers Fetal Testis Dysgenesis and Compromised Leydig Cell Function in Tgfbr3 (Betaglycan) Knockout Mice Biol Reprod, January 1, 2010; 82(1): 153 - 162. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |