Reproduction  
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS  

Reproduction (2007) 133 107-116
DOI: 10.1530/REP-06-0144
Copyright © 2007 Society for Reproduction and Fertility
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Greenfeld, C. R
Right arrow Articles by Flaws, J. A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Greenfeld, C. R
Right arrow Articles by Flaws, J. A

RESEARCH

BAX is involved in regulating follicular growth, but is dispensable for follicle atresia in adult mouse ovaries

Chuck R Greenfeld1, Janice K Babus2, Priscilla A Furth3, Sam Marion4, Patricia B Hoyer4 and Jodi A Flaws2,5

1 Departments of Physiology, 2 Epidemiology and Preventive Medicine, University of Maryland, Baltimore, Maryland 21201 USA, 3 Department of Oncology, Lombardi Cancer Center, Georgetown University, Washington, District of Columbia 20057, USA, 4 Department of Physiology, University of Arizona, Tucson, Arizona 85715, USA and 5 Department of Veterinary Biosciences, University of Illinois, Urbana, Illinois 61802, USA

Correspondence should be addressed to J A Flaws Department of Veterinary Biosciences, University of Illinois, Urbana, Illinois 61802, USA; Email: jflaws{at}uiuc.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Mammalian females are endowed with a finite number of primordial follicles at birth or shortly thereafter. Immediately following the formation of the primordial follicle pool, cohorts of these follicles are recruited to begin growth, and this recruitment continues until the primordial follicle population is depleted. Once recruited, a follicle will either grow and ovulate or undergo atresia. Follicle atresia results from the apoptotic death of follicular cells. Members of the BCL-2 family of proteins are important regulators of apoptosis in most cells including in the ovary. Here, we tested the hypothesis that the proapoptotic BAX is an important regulator of follicle survival. We used a variety of histological and biochemical techniques to investigate the impact of Bax deletion on follicle growth and death. We observed that the Bax deletion results in delayed vaginal opening and altered follicular growth. Young adult Bax-deficient ovaries contained increased numbers of primordial follicles and a trend towards reduced numbers of growing follicles. Bax deficiency led to a reduction in average litter size, and also a reduction in the number of oocytes ovulated in response to exogenous gonadotropins. In contrast, Bax deficiency did not alter follicle atresia. In conclusion, BAX appears to be an important regulator of follicle growth, but is dispensable for follicle atresia in mice.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Immediately following the formation of the primordial follicle population in mammalian ovaries, cohorts of follicles are recruited to begin growth. Follicle recruitment occurs continually throughout the female’s reproductive lifespan (Peters 1969; reviewed in Hirshfield 1991, Picton 2001). Though two recent papers (Johnson et al. 2004, 2005) have challenged the long-held view that oogenesis is restricted to embryonic life in the majority of mammalian species (Zuckerman 1951), skepticism (Greenfeld & Flaws 2004, Telfer et al. 2005), and a recent rebuttal (Eggan et al. 2006) refute these challenges. Thus, at present, it is predominately believed that the primordial follicle population is finite and that recruitment from the primordial follicle pool continues only until it has been depleted, at which point infertility ensues and the female is said to have entered reproductive senescence, or menopause in the case of humans (Peters 1969; reviewed in Hirshfield 1991). Once recruited into the growing population, a follicle has only two fates: ovulation or atresia (follicle death).

Once recruited to initiate growth, the flattened granulosa cells that surround the oocyte in primordial follicles differentiate into cuboidal cells and become mitotically active (reviewed in Hirshfield 1991). Continued proliferation drives the formation of multiple granulosa cell layers and the follicle transitions into first a primary then a secondary or preantral follicle. Preantral follicles also acquire an outer layer of theca cells around their basement membrane that are important for the steroidogenic activity of the antral follicle, the next follicle stage (Hirshfield 1991). Antral follicles are important as they contribute to the ovulatory follicle population and produce steroid hormones, most importantly estradiol (reviewed in Hirshfield 1991).

Follicle growth and survival are regulated by a variety of paracrine and endocrine factors. For example, growth within and beyond the primary stage is dependent on the actions of the paracrine factor kit ligand (KITL) and the growth differentiation factor (GDF)-9, which are expressed by granulosa cells and the oocyte respectively (Huang et al. 1993, Dong et al. 1996, Elvin et al. 1999; reviewed in Pangas & Matzuk 2004). Conversely, activin A is a negative regulator of preantral follicle growth, promoting these follicles to remain dormant and blocking follicle stimulating hormone (FSH)-induced granulosa cell proliferation (Mizunuma et al. 1999). FSH is critical for the transition of follicles to the antral stage (Kumar et al. 1997, Balla et al. 2003), and for the follicle survival beyond the early antral stage (Hirshfield 1986, 1988, Chun et al. 1996). On the other hand, FAS/FASL and tumor necrosis factor {alpha} (TNF{alpha}) promote follicle atresia (Kaipia et al. 1996, Hu et al. 2001, Morrison & Marcinkiewicz 2002, Sasson et al. 2002, Abdo et al. 2003).

Growing follicles that are not rescued by FSH undergo atresia (McGee & Hsueh 2000). Atresia, the fate of more than 99% of follicles (Morita & Tilly 1999), is an apoptotic process (Hughes & Gorospe 1991, Tilly et al. 1991), and depending on the follicle stage, it is initiated by oocyte (preantral follicles) or granulosa cell (antral follicle) death (reviewed in Reynaud & Driancourt 2000). Early antral follicles are most sensitive to atresia and require FSH action for survival (Hirshfield 1986, 1988, Chun et al. 1996).

Members of the BCL-2 protein family are important regulators of apoptosis in many cell types, and various BCL-2 family members are expressed in growing follicles, including the antiapoptotic BCL-2 and BCL-XL, and the proapoptotic BAX and BAK (reviewed in Hussein 2005). BAX is involved in mediating apoptosis of follicle cells under various conditions. For example, Tilly et al.(1995) found that Bax expression is reduced following in vivo eCG (an FSH analog) treatment in rats, and that follicles cultured in serum-free media in the absence of eCG underwent atresia and exhibited greatly increased Bax expression. Further, 4-vinylcyclohexene diepoxide (VCD) and the pesticide methoxychlor (MXC) induce atresia of small preantral and antral follicles respectively, and do so at least in part, through BAX-mediated mechanisms (Springer et al. 1996, Hu et al. 2001, Borgeest et al. 2004, Miller et al. 2005).

Genetic models have demonstrated the importance of Bcl-2 in the regulation of follicle atresia (Hsu et al. 1996, Morita et al. 1999, Flaws et al. 2006). Bax deletion was said to result in the presence of unusual atretic follicles, in which granulosa cells appeared unable to undergo apoptosis (Knudson et al. 1995). Further, Perez et al.(1999) demonstrated that atresia of immature follicles is attenuated by Bax deletion, leading to a slower depletion of the primordial follicle reserve and a lengthening of female reproductive lifespan. Neither of these reports, however, performed a quantitative assessment of the effect of Bax deletion on follicle growth and atresia at all stages of growth, and its impact on fertility. Such an assessment is warranted for several reasons. First, despite studies showing an involvement of Bax in the mediation of atresia by various factors, its physiological role in normal ovarian function is not well established. Second, as Bax appears to be involved in regulating oocyte death in immature follicles (Perez et al. 1999), the study of its role in regulating antral follicle atresia could highlight similarities or differences in the mechanisms regulating oocyte and granulosa cell death.

The objective of this study, therefore, was to investigate the effect of Bax deletion on ovarian function. Through various means, we tested the hypotheses that the enlarged follicle reserve in Bax/–ovaries impacts pubertal onset and estrous cyclicity; that Bax is involved in regulating follicle growth; and that Bax promotes follicular atresia.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Animals and treatment
Wild-type (WT) and Bax/– mice of C57BL/6 background were used in all experiments. Animals were housed in clear plastic cages and maintained on a 12 h light:12 h darkness cycle in a temperature-controlled room (24 ± 1 °C) with 35 ± 4% relative humidity. Mice were provided food and water ad libitum. The University of Maryland Institutional Animal Use and Care Committee approved all protocols involving mice.

Screening/genotyping mice
Ear-punch tissue collected from pups was lysed in a 9 µl water containing proteinase K (4 mg/ml; Ren et al. 2001). Tissue was digested for 30 min at room temperature (RT), followed by a 3-min incubation at 100 °C. The lysate was then subjected to PCR using the following primers: common primer GTTGACCAGAGTGGCGTAGG; WT allele-specific primer GAGCTGATCAGAACCATCATG; Bax/ allele-specific primer CCGCTTCCATTGCT-CAGCGG. The PCR conditions were as follows: 35 cycles of 94 °C for 45 s, 59 °C for 1 min 30 s, and 72 °C for 2 min. PCR products were sized by gel electrophoresis. WT mice were identified by the presence of only a 300 bp product, heterozygotes by both a 300 and 506 bp product, and Bax/– mice by only a 506 bp product. Only homozygous WTand Bax/–mice were used in each experiment.

Assessment of pubertal onset and estrous cyclicity
To assess the onset of puberty in juvenile females, mice were observed daily for signs of vaginal opening (Nishimura et al. 1989). Estrous cyclicity was monitored by daily vaginal lavage of females in the morning, for a period of at least 1 month beginning around 2 months of age, and the day of the cycle was determined based on vaginal cytology according to the classification of Pedersen (1970).

Histology
Ovaries were collected on the morning of estrus and fixed in Kahle’s solution (4% formalin, 28% ethanol, and 0.34 M glacial acetic acid) for at least 24 h. Following fixation, ovaries were dehydrated and embedded in Paraplast (VWR International, West Chester, PA, USA). Ovaries were serially sectioned at 8 µm intervals, mounted on glass slides, stained with Weigert’s hematoxylin, counterstained with picric acid methyl blue, dehydrated, and mounted in Permaslip (Alban Scientific, Inc., St Louis, MO, USA).

Assessment of follicle development
In every tenth ovarian section, the numbers of primordial, primary, preantral, and healthy antral follicles were counted. Only follicles containing an oocyte with a visible nucleus were counted to avoid double counting, and all counting was done without the knowledge of genotype. Follicles were counted as primordial if they contained an oocyte surrounded by flattened granulosa cells, or a mixture of <7 flattened and cuboidal granulosa cells (Meredith et al. 2000). Follicles were counted as primary if they contained an oocyte surrounded by a single layer of seven or more cuboidal granulosa cells. Preantral follicles were those containing an oocyte surrounded by two to four complete layers of granulosa cells. Antral follicles were considered as those that contained five or more complete granulosa cell layers with or without a visible antrum. Antral follicles were considered to be healthy if they had an intact oocyte and <10% pyknotic granulosa cells. Antral follicles were considered to be atretic if their oocyte was degenerating, or there were more than 10% pyknotic granulosa cells. All counts are reported as the raw number counted per ovary without a correction factor applied.

Assessment of apoptosis using terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assays
Ovaries were collected and fixed in Kahle’s solution, dehydrated, embedded in Paraplast, serially sectioned at 5–8 µm intervals, and mounted on glass slides. Sections were subjected to TUNEL analysis using the ApopTag peroxidase in situ apoptosis detection kit (Chemicon International, Temecula, CA, USA), according to the manufacturer’s instructions. Sections were counter-stained with crystal violet-free methyl green (FD Neuro Technologies, Inc., Baltimore, MD, USA), and then mounted in Permaslip. Apoptotic cells were classified as those staining dark brown by the assay.

Assessment of apoptosis using 3'-end labeling
Ovaries were collected from females aged 3 months on the morning of estrus and frozen at –70 °C until use. Ovaries from two females per genotype were pooled and DNA was isolated using the DNeasy kit (Qiagen). In each reaction, 0.5 µg DNA was labeled with [{alpha}32P]ddATP (GE Healthcare, formerly Amersham) using the Terminal Transferase Reaction kit (Roche Diagnostic Corporation). Labeled DNA was precipitated and separated on a 2% agarose gel. Individual lanes were excised from the gel after it was dried, and were subjected to scintillation counting.

In vitro assessment of atresia
Follicles were isolated from immature WT and Bax/ females following the procedure of Flaws et al.(1995). Females were dosed with 5 IU PMSG, and antral follicles were isolated in unsupplemented Eagle’s Minimum Essential Media (MEM; GIBCO) 2 days later. Follicles were either snap-frozen immediately upon collection (time 0, no incubation; n = 10 follicles per vial), or were cultured for 24 h at 37 °C in MEM supplemented with 0.1% BSA (Sigma), 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin sulfate, after which they were snap-frozen (n = 10 follicles per vial). Isolated DNA, 0.25–0.5 µg, was then subjected to 3'-end labeling reactions as above.

Estradiol assays
Blood was collected on the morning of estrus from WT and Bax/ mice and subjected to enzyme-linked immunosorbent assay (ELISA) for the measurement of estradiol levels. ELISA kits and reagents were obtained from Diagnostic Systems Laboratories, Inc. (Webster, TX, USA). The assay was run according to the manufacturer’s instructions. All samples were run in duplicate. The minimum detection limit, as stated in the instructions of the kit, was 7 pg/ml. The average intra- and interassay coefficients of variation were 4.2 and 8.2% respectively.

FSH assay
Blood was collected from WT and Bax/– mice on the morning of estrus and FSH assays were carried out by RIA using reagents from the National Hormone and Pituitary Distribution Program. Rat FSH hormone antigen, rat FSH antiserum, and mouse FSH RP were provided by the National Institute of Diabetes and Digestive and Kidney Diseases. Iodination reagents (IODO-BEADS 28665, 28666) were purchased from Pierce (Rockford, IL, USA). A standard curve was prepared and cold standards and samples (100 µl) were added to labeled tubes along with primary antibody (FSH at 1:1400) and iodinated FSH. Samples were shaken and stored at 4 °C overnight. On day 2, secondary antibody was added (1:10 dilution) along with 2% normal rabbit serum (Sigma-Aldrich) and incubated at RT for 5 min. The tubes were centrifuged for 15 min at 3000 r.p.m., supernatant was decanted, and pellets were counted in a gamma counter for 1 min each. All samples were run in duplicate. Sensitivity for the FSH assay was 200 pg/ml. The average intra- and interassay coefficients of variation were 6.7 and 2.7% respectively.

Statistical analysis
Follicle numbers between WT and Bax/–ovaries at 3 months of age were compared using Student’s t-test, as were the mean FSH and estradiol levels, age at puberty, and the percent of time spent in estrus. Follicle numbers between WT and Bax/– ovaries at 13 months of age were compared using Mann–Whitney tests due to the smaller number of animals and the distribution of the data. The 3'-end labeling data for Bax/–ovaries were normalized to WT values and the data were compared using a one-way t-test. Litter sizes were compared by one-way ANOVA. P values <0.05 were considered to be statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
We first assessed the effect of Bax deletion on the age at pubertal onset and estrous cyclicity. As shown in Fig. 1Go, vaginal opening was significantly delayed in Bax/– females (postnatal day (PN) 36.6 ± 0.9) when compared with WT females (PN 32.7 ± 0.8; n = 9 WT females; n = 8 Bax/ females; P<0.01). Shortly after the females reached puberty, we monitored estrous cyclicity for 1–1.5 months on a daily basis. As shown in Fig. 1Go, estrous cyclicity, based on the percentage of days that females exhibited an estrous smear, did not differ between Bax/– (16.1 ± 3.4%) and WT females (16.8 ± 4.7%; n = 6 WT females; n = 8 Bax/ females; P = 0.9).


Figure 1
View larger version (32K):
[in this window]
[in a new window]

 
Figure 1 Effect of Bax deletion on the onset of puberty and estrous cyclicity. (A) Age at vaginal opening in WT and Bax/– females; and (B) percentage of time spent in estrus in females aged 2–3 months. Bars represent mean ± S.E.M. *P<0.01.

 
We next investigated the effect of Bax deletion on folliculogenesis. To do this, we performed morphometric analysis of follicle numbers at 3 and 13 months of age and compared them between Bax/–and WT animals. Fig. 2AGo shows healthy follicle numbers for Bax/ and WT animals at 3 months of age. Bax/– ovaries contained significantly more primordial follicles (353.2 ± 42.4) when compared with WT ovaries (256.2 ± 19.3; n = 10 WTovaries; n = 9 Bax/–ovaries; P<0.05). The number of primary follicles was not different in Bax/ ovaries (207.0 ± 26.2) when compared with WT ovaries (168.6 ± 17.3; P = 0.23). There was a trend towards decreased numbers of larger growing follicles Bax/– ovaries. The number of preantral follicles in Bax/– (67.0 ± 6.3) was lower than in WT ovaries (85.7 ± 9.5; P = 0.13), as was the number of antral follicles (WT = 32.0 ± 3.8, Bax/– = 23.4 ± 2.5; P = 0.08), but neither was statistically significant. Interestingly, Bax/ ovaries contained both inclusion cysts (Fig. 3AGo), as well as large hemorrhagic cysts (Fig. 3BGo). While occasional inclusion cysts were observed in WT ovaries, we did not observe hemorrhagic cysts.


Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
Figure 2 Effect of Bax deletion on folliculogenesis. Healthy follicle numbers at (A) 3 months of age; and (B) 13 months of age. Bars represent mean ± S.E.M. *P<0.05.

 

Figure 3
View larger version (63K):
[in this window]
[in a new window]

 
Figure 3 Examples of cystic structures in Bax/–ovaries. (A) Inclusion cyst; (B) hemorrhagic cyst. Magnification x10, scale bar = 150 µm.

 
Follicle numbers at 13 months of age are shown in Fig. 2BGo. Bax/ ovaries contained significantly more primordial follicles (80.7 ± 19.9) when compared with WT ovaries (21.8 ± 4.8; n = 4 WT ovaries; n = 6 Bax/– ovaries; P<0.05). There were also significantly more primary follicles in Bax/ (89.3 ± 10.4) when compared with WT (48.5 ± 11.2) ovaries (P<0.05), as well as more preantral follicles in Bax/– (34.5 ± 7.5) when compared with WT (19.3 ± 3.3) ovaries (P<0.05). In contrast, there was no statistically significant difference in the number of antral follicles in Bax/– (16.7 ± 2.2) when compared with WT (10.0 ± 1.9) ovaries (P = 0.11).

As there was a strong statistical trend towards fewer antral follicles in Bax/– when compared with WT ovaries at 3 months of age, we retrospectively examined litter records to see if the average litter size was smaller in Bax/ when compared with WT females. We compared breedings between WT males and WT females, Bax+/– males and Bax+/ females, and Bax+/– males and Bax/– females (Fig. 4Go). When compared with WT breedings (10.68 ± 0.5 pups/l; n = 59), average litter size was decreased in both Bax+/ breedings (7.95+0.41) and Bax/– breedings (8.96 ± 0.25 pups/l; n = 138; P<0.005).


Figure 4
View larger version (44K):
[in this window]
[in a new window]

 
Figure 4 Effect of Bax deletion on average litter sizes for WT, Bax+/–, and Bax/– females. Bars represent mean ± S.E.M. *P<0.005 and {dagger}P<0.001.

 
Reduced litter sizes were not due to increased pup mortality prior to weaning due to an inability of Bax/– females to nurse. Bax/–females were able to nurse, as seen from the presence of milk in the stomach of neonatal pups, and the fact that the average weight of pups in litters from WT (12.4 ± 0.95 g; n = 3 litters) and Bax/ (12.3 ± 1.09 g; n = 5 litters; P = 0.95) dams were not different.

We next investigated the impact of Bax deletion on follicle atresia. As shown in Fig. 5AGo, we observed that there were similar numbers of atretic antral follicles in Bax/– (26.2 ± 2.2) when compared with WT (23.8 ± 2.2) ovaries at 3 months of age (P = 0.44). Since there was a trend towards fewer healthy antral follicles in Bax/–ovaries, the percentage of atretic antral follicles was significantly greater in Bax/–(53.1 ± 3.4%) when compared with WT mice (42.4 ± 3.3%; P<0.05; Fig. 5BGo). TUNEL analysis confirmed that pyknotic cells used to morphologically classify a follicle as atretic were in fact apoptotic cells (Fig. 5C and DGo).


Figure 5
View larger version (90K):
[in this window]
[in a new window]

 
Figure 5 Effect of Bax deletion on antral follicle atresia in vivo at 3 months of age. (A) Mean number of atretic antral follicles; (B) percentage of antral follicles that are atretic. Bars represent mean ± S.E.M. *P<0.05. TUNEL assays on (C) WT and (D) Bax/–ovaries. Arrows point to darkly stained, TUNEL-positive cells. Magnification x40, scale bar = 50 µm.

 
We next performed 3'-end labeling of DNA isolated from whole ovaries. There was no difference in the amount of labeling in Bax/– when compared with WT ovaries (Bax/ 130.8+27.6% of WT; P = 0.35; Fig. 6A and BGo). Similar to what we observed from 3'-end labeling experiments using whole ovaries, Bax/– follicles at time 0 h had similar labeling as WT follicles (Bax/– 117.8+12.9% of WT; P = 0.3; Fig. 6C and DGo). In contrast, Bax/–follicles collected following culture for 24 h in serum-free media had significantly less labeling when compared with WT follicles (Bax/ 74.3+4.7% of WT; Fig. 6C and DGo; P<0.05).


Figure 6
View larger version (61K):
[in this window]
[in a new window]

 
Figure 6 Effect of Bax deletion on atresia. 3'-End labeling of DNA isolated from whole ovaries at 3 months (A and B) or from follicles isolated from females at PN28 and cultured for 0 or 24 h in serum-free media (C and D). (A) Representative gel (X, blank; Y, WT; and Z, Bax/–); (B) fold increase of labeling of Bax/– DNA over WT DNA; (C) representative gel (Y0 = WT 0 h; Z0 = Bax/– 0 h; Y24 = WT 24 h; and Z24 = Bax/–24 h); and (D) fold increase of labeling of Bax/– DNA over WT DNA. Bars represent mean ± S.E.M. *P<0.05.

 
We next tested whether the strong statistical trend in the reduction of antral follicle numbers was due to decreased FSH production or responsiveness. FSH levels did not differ between Bax/ and WT females at PN35 and 3 months of age (Fig. 7AGo). Next, we performed superovulation experiments to investigate the responsiveness of Bax/– ovaries to exogenous gonadotropins (Fig. 7BGo). In response to gonadotropins, Bax/– females ovulated significantly fewer oocytes (31.14 ± 5.7) when compared with WT ovaries (54.5 ± 6.1; n = 8 WT females, n = 7 Bax/–females; P<0.05).


Figure 7
View larger version (29K):
[in this window]
[in a new window]

 
Figure 7 Effect of Bax deletion on hormone production and responsiveness to FSH. (A) Serum FSH levels at PN35 and PN90; (B) number of oocytes ovulated in response to exogenous gonadotropins; and (C) serum estradiol levels at 3 and 13 months. Bars represent mean ± S.E.M. *P<0.05.

 
Finally, we tested whether the strong statistical trend in the reduction of growing follicles was due to altered estradiol production. To do this we measured serum estradiol levels. As shown in Fig. 7CGo, estradiol levels at 3 months of age were significantly higher in Bax/– (97.95 ± 7.2 pg/ml) when compared with WT females (69.9 ± 6.1 pg/ml; n = 4 WT females, n = 4 Bax/– females; P<0.05). At 13 months of age, however, estradiol levels were equivalent between Bax/– and WT females (P = 0.6).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
This study demonstrates the importance of Bax in the regulation of female reproductive physiology. We observed that the age at vaginal opening was delayed in Bax/– when compared with WT females. The age at vaginal opening is an indicator of the onset of puberty, and thus, these data suggest that puberty is delayed following Bax deletion. It is possible though that Bax deficiency impacts the physical process of vaginal opening itself. FSH levels at PN35, around the time of pubertal onset, are equivalent between WTand Bax/– females, suggesting that rather than affecting hormone production, Bax deletion interferes with apoptosis in the vaginal mucosa. Vaginal opening is an apoptotic event stimulated by estradiol and regulated by BCL-2 family members (Rodriguez et al. 1997) and thus, delayed vaginal opening in Bax/– females is likely due to an absence of Bax in the vaginal mucosa, and defective apoptosis of these cells.

As BAX is a proapoptotic protein that is expressed in the ovary, and has been shown to be involved in regulating immature follicle atresia and the mediation of follicle atresia induced by a variety of toxicants (Tilly et al. 1995, Springer et al. 1996, Perez et al. 1999, Hu et al. 2001, Matikainen et al. 2001, Borgeest et al. 2004, Miller et al. 2005), we hypothesized that Bax deletion would enhance follicle survival and lead to the presence of increased numbers of healthy follicles. This was not the case, and instead, we observed a defect in folliculogenesis following Bax deletion. We observed increased primordial follicle numbers in young adult Bax/– when compared with WT mice, corroborating the results of Perez et al.(1999). Further, we observed that, while primary follicle numbers were not different, there was a statistical trend towards reduced numbers of preantral (P = 0.13) and antral (P = 0.08) follicles in Bax/ when compared with WT ovaries on the morning of estrus. The early antral follicles present on the morning of estrus represent the pool from which ovulatory follicles will be selected. Thus, our data showing reduced numbers of these follicles in Bax/ when compared with WT ovaries, suggest that fewer antral follicles are available to be selected to grow to the ovulatory stage in Bax/– when compared with WT ovaries. This is supported by the fact that significantly fewer oocytes were ovulated in Bax/– when compared with WT females in response to exogenous gonadotropins. Exogenous gonadotropin treatment recruits additional large secondary follicles into the ovulatory pool, and its effects are dependent on the number of these follicles when it is administered (Hirshfield 1991). Since Bax/– females ovulated fewer follicles in response to gonadotropin treatment, it suggests that fewer follicles were available for cyclic recruitment (i.e., the recruitment during each cycle of antral follicles from the growing pool of secondary follicles (McGee & Hsueh 2000)).

The biological significance of Bax deletion is further supported by the fact that litter sizes were reduced in Bax/ females when compared with WT females. While it is possible that decreased litter sizes were due to the fact that we used Bax+/– males in our breedings, we feel that differences in litter size were due to a female defect. Despite the fact that Bax/– males are infertile due to an inability of spermatozoa to enter meiosis (Knudson et al. 1995), and heterozygous breedings in this study produced smaller litter sizes when compared with WTs, Russell et al.(2002) demonstrated that Bax+/ males are fertile and phenotypically identical to WT males. Therefore, we think that decreased litter sizes are due to a female cause, and we believe that this caused reduced antral follicle numbers in Bax/– ovaries. Future studies should examine Bax/–ovaries at other times during the estrous cycle to determine if the number of preovulatory follicles is reduced when compared with WT.

The reduced number of healthy antral follicles in Bax/ ovaries is not due to altered atresia. This suggests that, in some way, Bax deficiency perturbs the process of cyclic recruitment, such that in its absence the proper number of antral follicles growing to ovulation is not maintained. The feedback loop of estradiol and inhibin on FSH production normally acts to tightly regulate the number of antral follicles (Hirshfield 1991). Even though there were fewer preantral follicles in Bax/ ovaries, we would have expected that this feedback loop would have acted to rescue an increased percentage of these follicles to maintain ovulatory capacity. This is seen in models of chemical reduction of follicular reserve size, in which there is a great reduction in the number of immature follicles, but no difference in the number of mature healthy follicles (Hirshfield 1994).

It is unclear how Bax deletion might affect cyclic recruitment. Our data suggest that it is not due to decreased FSH output. Further, it does not appear to be due to reduced estradiol production. This was surprising given that there are fewer antral follicles, and antral follicles produce estradiol. A similar finding, however, has been seen by others. For example, Anzalone et al.(2001) observed that middle-aged unilateral ovari-ectomized rats produced similar amounts of estradiol as young intact rats, despite the fact that they had significantly fewer growing follicles. Reduced numbers of growing follicles in Bax/– ovaries could be due to defective follicle growth, potentially due to reduced granulosa cell proliferation. Recent data have demonstrated that BCL-2 family members regulate cellular proliferation (reviewed in Bonnefoy-Berard et al. 2004), and Knudson et al.(2001) showed that overexpression of Bax enhances proliferation of thymocytes. Thus, it is possible that in the absence of Bax, granulosa cell proliferation is reduced, and this could be due to a defect downstream of estradiol.

Similar to the results of Perez et al.(1999), we observed a prolonged maintenance of an enlarged follicular reserve in Bax/ ovaries. Further, we also observed significantly more immature growing follicles, but similar number of antral follicles in Bax/– when compared with WT ovaries late in life. The reversal in follicle number differences between Bax/ and WT ovaries at 13 months when compared with 3 months, i.e. there were more growing follicles in Bax/– when compared with WT ovaries at 13 months and fewer at 3 months, is likely due to the fact that the follicular reserve in WT mice is nearly exhausted and follicle output is diminishing, and not due to accelerated growth in Bax/– ovaries.

The most surprising observation in this study was that Bax deletion did not affect the amount of antral follicle atresia in vivo. Unaltered follicle atresia following Bax deletion is surprising based on a study by Knudson et al.(1995), in which it was stated that granulosa cell apoptosis is reduced following Bax deletion. However, this was based on the observation of abnormal follicle structures in Bax/– ovaries without biochemical assessment of granulosa cell apoptosis. We demonstrated here via morphological and biochemical means that Bax-deficient granulosa cells are fully competent to undergo apoptosis. This was evidenced by the fact that there were similar numbers of atretic antral follicles in Bax/– when compared with WT ovaries, and that the total amount of apoptosis occurring in Bax/ when compared with WT ovaries was similar. Further, TUNEL analysis demonstrated the presence of apoptotic granulosa cells in Bax/ ovaries. These data suggest that in vivo there is a redundant factor(s) that promotes follicle atresia in the absence of BAX. A likely candidate is BAK, which has been shown in a variety of cell types to have a redundant function with BAX. In some cells, the deletion of both factors is required to affect apoptosis (Lindsten et al. 2000, Wei et al. 2001, Zong et al. 2001, Degenhardt et al. 2002). Therefore, it is possible that BAK is able to function in the absence of BAX to promote follicle atresia.

Interestingly, if there is redundancy between BAX and BAK, it does not extend to all means of induction of atresia. This is based on the observation that there were different consequences of Bax deletion on follicle atresia in vivo and in vitro. When follicles were cultured in serum-free media for 24 h, Bax/ follicles underwent less apoptosis than WT follicles. Serum-free culture mimics a growth factor withdrawal situation. A protective effect of Bax deletion on oocyte viability following growth factor withdrawal has been demonstrated (De Felici et al. 1999, Stallock et al. 2003), suggesting that granulosa cells are similarly less susceptible to death following growth factor withdrawal in the absence of Bax.

That Bax deficiency is protective to follicles in vitro, but not in vivo, suggests that an extra-follicular atretogenic factor(s) may exist that acts via a BAX-independent pathway to promote follicle atresia. A major cause of atresia is FSH withdrawal, which leads to a reduction in the intra-follicular expression of survival proteins, such as XIAP and FLIP, and an increase in the intra-follicular expression of death factors, such as FAS/FASL (Hirshfield 1986, 1988, Chun et al. 1996; reviewed in Jiang et al. 2003). Since Bax deletion is protective to isolated follicles, but not to intact follicles, extra-follicular factors may also be involved in promoting atresia. It is also possible that the array of factors whose expression changes following FSH withdrawal is different in isolated versus intact follicles, such that in vivo, factors are involved that act via a BAX-independent pathway to promote atresia.

That Bax deletion does not protect antral follicles from atresia in vivo, contrasts Perez et al.(1999) who observed that Bax deletion attenuates small follicle atresia. As atresia of immature follicles is initiated by oocyte death and antral follicle atresia is initiated by granulosa cell death (reviewed in Reynaud & Driancourt 2000), our data, together with those of Perez et al.(1999), suggest that different mechanisms act to regulate apoptosis in oocytes and granulosa cells. Thus, as atresia of small follicles is reduced by Bax deletion (Perez et al. 1999), it appears that oocyte death proceeds via a BAX-dependent pathway, whereas granulosa cells die via a BAX-independent pathway.

In summary, we have shown that Bax is important for normal follicle development, but that under physiological conditions, it is dispensable for antral follicle atresia. Our data support the idea that follicle atresia is an active process in vivo, and that it may involve extra- as well as intra-follicular death-inducing factors. Future studies using the Bax-deficient model will be useful in determining whether extra-follicular factors are important for stimulating atresia, and for their identification.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
This work was supported by NIH 38955, T32HD07170. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    Footnotes
 
Received 18 August 2006
First decision 8 September 2006
Accepted 25 September 2006


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 

Abdo M, Hisheh S & Dharmarajan A 2003 Role of tumor necrosis factor-alpha and the modulating effect of the caspases in rat corpus luteum apoptosis. Biology of Reproduction 68 1241–1248.[Abstract/Free Full Text]

Anzalone CR, Hong LS, Lu JK & LaPolt PS 2001 Influences of age and ovarian follicular reserve on estrous cycle patterns, ovulation, and hormone secretion in the Long–Evans rat. Biology of Reproduction 64 1056–1062.[Abstract/Free Full Text]

Balla A, Danilovich N, Yang Y & Sairam MR 2003 Dynamics of ovarian development in the FORKO immature mouse: structural and functional implications for ovarian reserve. Biology of Reproduction 69 1281–1293.[Abstract/Free Full Text]

Bonnefoy-Berard N, Aouacheria A, Verschelde C, Quemeneur L, Marcais A & Marvel J 2004 Control of proliferation by Bcl-2 family members. Biochimica et Biophysica Acta 1644 159–168.[Medline]

Borgeest C, Miller KP, Gupta R, Greenfeld C, Hruska KS, Hoyer P & Flaws JA 2004 Methoxychlor-induced atresia in the mouse involves Bcl-2 family members, but not gonadotropins or estradiol. Biology of Reproduction 70 1828–1835.[Abstract/Free Full Text]

Chun SY, Eisenhauer KM, Minami S, Billig H, Perlas E & Hsueh AJ 1996 Hormonal regulation of apoptosis in early antral follicles: follicle-stimulating hormone as a major survival factor. Endocrinology 137 1447–1456.[Abstract]

De Felici M, Di Carlo A, Pesce M, Iona S, Farrace MG & Piacentini M 1999 Bcl-2 and bax regulation of apoptosis in germ cells during prenatal oogenesis in the mouse embryo. Cell Death and Differentiation 6 908–915.[CrossRef][Web of Science][Medline]

Degenhardt K, Sundararajan R, Lindsten T, Thompson C & White E 2002 Bax and Bak independently promote cytochrome c release from mitochondria. Journal of Biological Chemistry 277 14127–14134.[Abstract/Free Full Text]

Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N & Matzuk MM 1996 Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 383 531–555.[CrossRef][Medline]

Eggan K, Jurga S, Gosden R, Min IM & Wagers AJ 2006 Ovulated oocytes in adult mice derive from non-circulating germ cells. Nature 441 1109–1114.[CrossRef][Medline]

Elvin JA, Yan C, Wang P, Nishimori K & Matzuk MM 1999 Molecular characterization of the follicle defects in the growth differentiation factor 9-deficient ovary. Molecular Endocrinology 13 1018–1034.[Abstract/Free Full Text]

Flaws JA, DeSanti A, Tilly KI, Javid RO, Kugu K, Johnson AL, Hirshfield AN & Tilly JL 1995 Vasoactive intestinal peptide-mediated suppression of apoptosis in the ovary: potential mechanisms of action and evidence of a conserved antiatretogenic role through evolution. Endocrinology 136 4351–4359.[Abstract]

Flaws JA, Marion SL, Miller KP, Christian PJ, Babus JK & Hoyer PB 2006 Effect of bcl-2 overexpression in mice on ovotoxicity caused by 4-vinylcyclohexene. Toxicology and Applied Pharmacology 215 51–56.[CrossRef][Web of Science][Medline]

Greenfeld C & Flaws JA 2004 Renewed debate over postnatal oogenesis in the mammalian ovary. BioEssays 26 829–832.[CrossRef][Web of Science][Medline]

Hirshfield AN 1986 Effect of low dose of pregnant mare’s serum gonadotropin on follicular recruitment and atresia in cycling rats. Biology of Reproduction 35 113–118.[Abstract]

Hirshfield AN 1988 Size-frequency analysis of atresia in cycling rats. Biology of Reproduction 38 1181–1188.[Abstract]

Hirshfield AN 1991 Development of follicles in the mammalian ovary. International Review of Cytology 124 43–101.[Web of Science][Medline]

Hirshfield AN 1994 Relationship between the supply of primordial follicles and the onset of follicular growth in rats. Biology of Reproduction 50 421–428.[Abstract]

Hsu SY, Lai RJ, Finegold M & Hsueh AJ 1996 Targeted overexpression of Bcl-2 in ovaries of transgenic mice leads to decreased follicle apoptosis, enhanced folliculogenesis, and increased germ cell tumorigenesis. Endocrinology 137 4837–4843.[Abstract]

Hu X, Christian P, Sipes IG & Hoyer PB 2001 Expression and redistribution of cellular bad, bax, and bcl-xL protein is associated with VCD-induced ovotoxicity in rats. Biology of Reproduction 65 1489–1495.[Abstract/Free Full Text]

Huang EJ, Manova K, Packer AI, Sanchez S, Bachvarova RF & Besmer P 1993 The murine steel panda mutation affects kit ligand expression and growth of early ovarian follicles. Developmental Biology 157 100–109.[CrossRef][Web of Science][Medline]

Hughes FM Jr & Gorospe WC 1991 Biochemical identification of apoptosis (programmed cell death) in granulosa cells: evidence for a potential mechanism underlying follicular atresia. Endocrinology 129 2415–2422.[Abstract/Free Full Text]

Hussein MR 2005 Apoptosis in the ovary: molecular mechanisms. Human Reproduction Update 11 161–177.

Jiang JY, Cheung CK, Wang Y & Tsang BK 2003 Regulation of cell death and cell survival gene expression during ovarian follicular development and atresia. Frontiers in Bioscience 8 d222–d237.[Web of Science][Medline]

Johnson J, Canning J, Kaneko T, Pru JK & Tilly JL 2004 Germline stem cells and follicular renewal in the postnatal mammalian ovary. Nature 428 145–150.[CrossRef][Medline]

Johnson J, Bagley J, Skaznik-Wikiel M, Lee HJ, Adams GB, Niikura Y, Tschudy KS, Tilly JC, Cortes ML, Forkert R, Spitzer T, Iacomini J, Scadden DT & Tilly JL 2005 Oocyte generation in adult mammalian ovaries by putative germ cells in bone marrow and peripheral blood. Cell 122 303–315.[CrossRef][Web of Science][Medline]

Kaipia A, Chun SY, Eisenhauer K & Hsueh AJ 1996 Tumor necrosis factor-alpha and its second messenger, ceramide, stimulate apoptosis in cultured ovarian follicles. Endocrinology 137 4864–4870.[Abstract]

Knudson CM, Tung KS, Tourtellotte WG, Brown GA & Korsmeyer SJ 1995 Bax-deficient mice with lymphoid hyperplasia and male germ cell death. Science 270 96–99.[Abstract/Free Full Text]

Knudson CM, Johnson GM, Lin Y & Korsmeyer SJ 2001 Bax accelerates tumorigenesis in p53-deficient mice. Cancer Research 61 659–665.[Abstract/Free Full Text]

Kumar TR, Wang Y, Lu N & Matzuk MM 1997 Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nature Genetics 15 201–204.[CrossRef][Web of Science][Medline]

Lindsten T, Ross AJ, King A, Zong WX, Rathmell JC, Shiels HA, Ulrich E, Waymire KG, Mahar P, Frauwirth K, Chen Y, Wei M, Eng VM, Adelman DM, Simon MC, Ma A, Golden JA, Evan G, Korsmeyer SJ, MacGregor GR & Thompson CB 2000 The combined functions of proapoptotic Bcl-2 family members Bak and Bax are essential for normal development of multiple tissues. Molecules and Cells 6 1389–1399.

Matikainen T, Perez GI, Jurisicova A, Pru JK, Schlezinger JJ, Ryu HY, Laine J, Sakai T, Korsmeyer SJ, Casper RF, Sherr DH & Tilly JL 2001 Aromatic hydrocarbon receptor-driven Bax gene expression is required for premature ovarian failure caused by biohazardous environmental chemicals. Nature Genetics 28 355–360.[CrossRef][Web of Science][Medline]

McGee EA & Hsueh AJ 2000 Initial and cyclic recruitment of ovarian follicles. Endocrine Reviews 21 200–214.[Abstract/Free Full Text]

Meredith S, Dudenhoeffer G & Jackson K 2000 Classification of small type B/C follicles as primordial follicles in mature rats. Journal of Reproduction and Fertility 119 43–48.[Abstract]

Miller KP, Gupta RK, Greenfeld CR, Babus JK & Flaws JA 2005 Methoxychlor directly affects ovarian antral follicle growth and atresia through bcl-2- and bax-mediated pathways. Toxicological Sciences 88 213–221.[Abstract/Free Full Text]

Mizunuma H, Liu X, Andoh K, Abe Y, Kobayashi J, Yamada K, Yokota H, Ibuki Y & Hasegawa Y 1999 Activin from secondary follicles causes small preantral follicles to remain dormant at the resting stage. Endocrinology 140 37–42.[Abstract/Free Full Text]

Morita Y & Tilly JL 1999 Oocyte apoptosis: like sand through an hourglass. Developmental Biology 213 1–17.[CrossRef][Web of Science][Medline]

Morita Y, Perez GI, Maravei DV, Tilly KI & Tilly JL 1999 Targeted expression of Bcl-2 in mouse oocytes inhibits ovarian follicle atresia and prevents spontaneous and chemotherapy-induced oocyte apoptosis in vitro. Molecular Endocrinology 13 841–850.[Abstract/Free Full Text]

Morrison LJ & Marcinkiewicz JL 2002 Tumor necrosis factor {alpha} enhances oocyte/follicle apoptosis in the neonatal rat ovary. Biology of Reproduction 66 450–457.[Abstract/Free Full Text]

Nishimura K, Utsumi K, Yuhara M, Fujitani Y & Iritani A 1989 Identification of puberty-accelerating pheromones in male mouse urine. Journal of Experimental Zoology 251 300–305.[CrossRef][Web of Science][Medline]

Pangas SA & Matzuk MM 2004 Genetic models for transforming growth factor ß superfamily signaling in ovarian follicle development. Molecular and Cellular Endocrinology 225 83–91.[CrossRef][Web of Science][Medline]

Pedersen T 1970 Follicle kinetics in the ovary of the cyclic mouse. Acta Endocrinologica 64 304–323.[Abstract/Free Full Text]

Perez GI, Robles R, Knudson CM, Flaws JA, Korsmeyer SJ & Tilly JL 1999 Prolongation of ovarian lifespan into advanced chronological age by Bax-deficiency. Nature Genetics 21 200–203.[CrossRef][Web of Science][Medline]

Peters H 1969 The development of the mouse ovary from birth to maturity. Acta Endocrinologica 62 98–116.[Abstract/Free Full Text]

Picton HM 2001 Activation of follicle development: the primordial follicle. Theriogenology 55 1193–1210.[CrossRef][Web of Science][Medline]

Ren S, Li M, Cai H, Hudgins S & Furth PA 2001 A simplified method to prepare PCR template DNA for screening of transgenic and knockout mice. Contemporary Topics in Laboratory Animal Science 40 27–30.[Web of Science][Medline]

Reynaud K & Driancourt MA 2000 Oocyte attrition. Molecular and Cellular Endocrinology 163 101–108.[CrossRef][Web of Science][Medline]

Rodriguez I, Araki K, Khatib K & Martinou JC 1997 Mouse vaginal opening is an apoptosis-dependent process which can be prevented by the overexpression of Bcl2. Developmental Biology 184 115–121.[CrossRef][Web of Science][Medline]

Russell LD, Chiarini-Garcia H, Korsmeyer SJ & Knudson CM 2002 Bax-dependent spermatogonia apoptosis is required for testicular development and spermatogenesis. Biology of Reproduction 66 950–958.[Abstract/Free Full Text]

Sasson R, Winder N, Kees S & Amsterdam A 2002 Induction of apoptosis in granulosa cells by TNF alpha and its attenuation by glucocorticoids involve modulation of Bcl-2. Biochemical and Biophysical Research Communications 294 51–59.[CrossRef][Web of Science][Medline]

Springer LN, Tilly JL, Sipes IG & Hoyer PB 1996 Enhanced expression of bax in small preantral follicles during 4-vinylcyclohexene diepoxide-induced ovotoxicity in the rat. Toxicology and Applied Pharmacology 139 402–410.[CrossRef][Web of Science][Medline]

Stallock J, Molyneaux K, Schaible K, Knudson CM & Wylie C 2003 The pro-apoptotic gene Bax is required for the death of ectopic primordial germ cells during their migration in the mouse embryo. Development 130 6589–6597.[Abstract/Free Full Text]

Telfer EE, Gosden RG, Byskov AG, Spears N, Albertini D, Yding Andersen C, Anderson R, Braw-Tal R, Clarke H, Gougeon A, McLaughlin E, McLaren A, McNatty K, Schatten G, Silber S & Tsafriri A 2005 On regenerating the ovary and generating controversy. Cell 122 821–822.[CrossRef][Web of Science][Medline]

Tilly JL, Kowalski KI, Johnson AL & Hsueh AJ 1991 Involvement of apoptosis in ovarian follicular atresia and postovulatory regression. Endocrinology 129 2799–2801.[Abstract/Free Full Text]

Tilly JL, Tilly KI, Kenton ML & Johnson AL 1995 Expression of members of the bcl-2 gene family in the immature rat ovary: equine chorionic gonadotropin-mediated inhibition of granulosa cell apoptosis is associated with decreased bax and constitutive bcl-2 and bcl-xlong messenger ribonucleic acid levels. Endocrinology 136 232–241.[Abstract]

Wei MC, Zong WX, Chen EH, Lindsten T, Panoutsakopoulou V, Ross AJ, Roth KA, MacGregor GR, Thompson CB & Korsmeyer SJ 2001 Proapoptotic BAX and BAK: a requisite gateway to mitochondrial dysfunction and death. Science 292 727–730.[Abstract/Free Full Text]

Zong WX, Lindsten T, Ross AJ, MacGregor GR & Thompson CB 2001 proteins that bind pro-survival Bcl-2 family members fail to induce apoptosis in the absence of Bax and Bak. Genes & Development 15 1481–1486.[Abstract/Free Full Text]

Zuckerman S 1951 The number of oocytes in the mature ovary. Recent Progress in Hormone Research 6 63–108.[Medline]


This article has been cited by other articles:


Home page
Mol Hum ReprodHome page
P. A. Fowler, N. J. Dora, H. McFerran, M. R. Amezaga, D. W. Miller, R. G. Lea, P. Cash, A. S. McNeilly, N. P. Evans, C. Cotinot, et al.
In utero exposure to low doses of environmental pollutants disrupts fetal ovarian development in sheep
Mol. Hum. Reprod., May 1, 2008; 14(5): 269 - 280.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Mayo, L. Jameson, and T. K. Woodruff
Eggs in the Nest
Endocrinology, August 1, 2007; 148(8): 3577 - 3579.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Greenfeld, C. R
Right arrow Articles by Flaws, J. A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Greenfeld, C. R
Right arrow Articles by Flaws, J. A


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS