Reproduction   citetrack
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS  

Reproduction (2006) 132 919-929
DOI: 10.1530/REP-06-0068
Copyright © 2006 Society for Reproduction and Fertility
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by White, F. J
Right arrow Articles by Johnson, G. A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by White, F. J
Right arrow Articles by Johnson, G. A

RESEARCH

Secreted phosphoprotein 1 (osteopontin) is expressed by stromal macrophages in cyclic and pregnant endometrium of mice, but is induced by estrogen in luminal epithelium during conceptus attachment for implantation

Frankie J White1,2, Robert C Burghardt1,2, Jianbo Hu1,3, Margaret M Joyce1,2, Thomas E Spencer1,3 and Greg A Johnson1,2

1 Center for Animal Biotechnology and Genomics, 2 Department of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences and 3 Department of Animal Science, College of Agriculture and Life Sciences, Texas A&M University, College Station, Texas 77843-4458, USA

Correspondence should be addressed to G A Johnson, Department of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, Texas 77843-4458, USA; Email: gjohnson{at}cvm.tamu.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Secreted phosphoprotein 1 (SPP1, osteopontin) is the most highly upregulated extracellular matrix/adhesion molecule/cytokine in the receptive phase human uterus, and Spp1 null mice manifest decreased pregnancy rates during mid-gestation as compared with wild-type counterparts. We hypothesize that Spp1 is required for proliferation, migration, survival, adhesion, and remodeling of cells at the conceptus–maternal interface. Our objective was to define the temporal/spatial distribution and steroid regulation of Spp1 in mouse uterus during estrous cycle and early gestation. In situ hybridization localized Spp1 to luminal epithelium (LE) and immune cells. LE expression was prominent at proestrus, decreased by estrus, and was nearly undetectable at diestrus. During pregnancy, Spp1 mRNA was not detected in LE until day 4.5 (day 1 = vaginal plug). Spp1-expressing immune cells were scattered within the endometrial stroma throughout the estrous cycle and early pregnancy. Immunoreactive Spp1 was prominent at the apical LE surface by day 4.5 of pregnancy and Spp1 protein was also co-localized with subsets of CD45-positive (leukocytes) and F4/80-positive (macrophages) cells. In ovariectomized mice, estrogen, but not progesterone, induced Spp1 mRNA, whereas estrogen plus progesterone did not induce Spp1 in LE. These results establish that estrogen regulates Spp1 in mouse LE and are the first to identify macrophages that produce Spp1 within the peri-implantation endometrium of any species. We suggest that Spp1 at the apical surface of LE provides a mechanism to bridge conceptus to LE during implantation, and that Spp1-positive macrophages within the stroma may be involved in uterine remodeling for conceptus invasion.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Implantation involves pregnancy-specific remodeling of extracellular matrix (ECM) and adhesion molecules at the conceptus–maternal interface (Carson et al. 2000, Dey et al. 2004). Adhesion proteins and/or ECM molecules, cell-surface receptors, and growth factors comprise over 20% of the genes that change expression as the human endometrium transforms to an implantation-receptive state (Carson et al. 2002). These molecules are hypothesized to have direct roles in conceptus attachment, invasion, and placental development. Pregnancy loss due to defects in implantation is a major cause of infertility in humans, and it is of clinical importance to identify the genes as well as the cellular the molecular mechanisms that underlie this critical ECM/adhesion molecule-dependent crosstalk between conceptus and uterus (Norwitz et al. 2001). Recent global gene profiling using high-density microarray technology indicates that secreted phosphoprotein 1 (SPP1; also identified as osteopontin, bone sialoprotein 1 and early T-lymphocyte activation factor 1) is the most highly upregulated ECM-adhesion molecule in the human uterus as it becomes receptive to implantation (Carson et al. 2002, Kao et al. 2002, Mirkin et al. 2005).

SPP1 is a glycoprotein member of the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of genetically related ECM proteins recognized as key players in diverse processes, such as bone mineralization, cancer metastasis, cell-mediated immune responses, inflammation, and angiogenesis (Butler et al. 1996, Weber & Cantor 1996, Giachelli & Steitz 2000, Denhardt et al. 2003). SPP1 has potential to influence tissue remodeling at the conceptus–maternal interface by affecting cell–cell and cell–ECM communication, increasing cell proliferation, migration and survival, and regulating local cytokine networks (Johnson et al. 2003b). Indeed, temporal and spatial patterns of SPP1 expression within the uterus and the placenta of species with different placentation including rabbits, sheep, and humans suggest important roles during pregnancy. Depending on the species, SPP1 mRNA is induced in either the luminal epithelium (LE) or glandular epithelium (GE) during the peri-implantation period (Johnson et al. 1999a, 1999b, Apparao et al. 2001, 2003, von Wolff et al. 2001), and GE expression increases throughout pregnancy in the sheep (Johnson et al. 2003a). Regardless of the placental type, the result is a consistent allocation of SPP1 protein to the conceptus/maternal interface where it is proposed to provide a conserved mechanism for stimulating changes in morphology and mediating adhesion between conceptus and uterine tissues essential for implantation and placentation (Johnson et al. 2003b).

There is evidence to suggest that Spp1 has a role(s) in mouse pregnancy. Spp1 null mice manifest decreased pregnancy rates during mid-gestation as compared with wild-type counterparts (Weintraub et al. 2004), suggesting peri-implantation pregnancy loss. While it has been reported that Spp1 is expressed in mouse decidua, Spp1 expression during the peri-implantation period has not been investigated completely (Nomura et al. 1988, Waterhouse et al. 1992). Therefore, as a basis for experiments to determine the mechanistic nature of critical functions of Spp1 during the peri-implantation period, the objectives of these studies were to describe the temporal and the spatial changes in Spp1 mRNA and protein in the mouse uterus during early gestation that may underlie the reproductive phenotype in Spp1 null mice, and to determine whether these changes can be attributed to alterations in steroid hormones.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Animals and tissue collection
All experimental and surgical procedures complied with the Guide for Care and Use of Laboratory Animals and were approved by the Texas A&M University Laboratory Animal Care Committee.

Temporal and spatial changes in Spp1 expression were evaluated in the uteri of adult-outbred CD-1 (Charles River Laboratories, Inc., Raleigh, NC, USA) mice during estrous cycle and pregnancy. Female mice were assigned randomly to cyclic or pregnant status, and those assigned to pregnant status were mated to intact fertile males of the same strain. Uteri were then collected during estrus, diestrus, and proestrus of the estrous cycle and on days 3, 4, 4.5, 5, and 6 of pregnancy (n = 8 per day; day 1 defined as the day of vaginal plug).

Ovarian estrogen and progesterone advance the pre-receptive uterus to the receptive state, and the nidatory surge of estrogen initiates the attachment phase of implantation. Therefore, to examine the effects of progesterone and estrogen on Spp1 gene expression, female-outbred CD-1 mice were ovariectomized and 2 weeks later injected subcutaneously with sesame oil (0.1 ml/mouse), estradiol (100 ng/mouse), progesterone (2 mg/mouse), or both estradiol and progesterone (n = 8 per treatment) in sesame oil. Uteri were collected 24 h after treatment.

Several sections from uterine horns collected from one half of the mice for each treatment or day were fixed in fresh 4% paraformaldehyde in PBS (pH 7.2) and then embedded in Paraplast-Plus (Oxford Laboratory, St Louis, MO, USA). Uteri of the remaining mice from each treatment were embedded in Tissue-Tek optimal cutting temperature Compound (Miles, Oneonta, NY, USA), snap-frozen in liquid nitrogen, and stored at –80 °C prior to sectioning.

Real-time RT-PCR analysis
Total cellular RNA was isolated from frozen uteri using Trizol reagent (Invitrogen). Concentrations of Spp1 mRNA were determined by real-time RT-PCR. Primers were created from the murine Spp1 sequence (Gene-Bank Accession number X51834 [GenBank] ). Reactions contained 24 µl of the following reagents: 0.5 µl SPP1 forward primer from 10 µM solutions (sequence: TTGGTGACTTGGTGGTGATCT), 0.2 µl Spp1 reverse primer from 10 µM solutions (sequence: GACAAGAT-GAGGCACAGTTGATGTCTTG(FAM)C; Invitrogen), 0.25 µl ß-actin forward primer (Invitrogen), 0.25 µl ß-actin reverse primer, 12.5 µl RT-PCR master mix (Invitrogen), 0.5 µl reverse transcriptase mix (Invitrogen), 0.5 µl ROX reference dye (Invitrogen), 1.5 µl MgCl, and 7.5 µl RNase-free water (Qiagen). Reactions also included 1 µl (100 ng) total RNA. The reverse primer of Spp1 was labeled with a reporter dye (FAM; D-LUX; Invitrogen) that allowed amplification of RNA to be evaluated on an ABI PRISM 7700 sequence detection system (Applied Biosystems, Foster City, CA, USA). The reaction conditions consisted of one cycle to reverse transcribe RNA (50 °C for 15 min then 95 °C for 2 min) followed by 45 cycles to amplify cDNA (95 °C for 15 s then 60 °C for 30 s). Appropriate controls were conducted to ensure that genomic DNA did not influence the amplification of the template. Following amplification, the RT-PCR product was analyzed on a 2% agarose gel to further validate size. The relative concentration of Spp1 mRNA was determined in the same samples via the comparative CT method with ß-actin as the normalization control (JOE labeled certified LUX Primer Set; Invitrogen). Data were analyzed by assigning an arbitrary threshold cycle (CT) for amplification plots, where the CT for a sample was the cycle that its amplification plot crossed the threshold. The CT was assigned in the log-linear range of amplification. The SPP1 {Delta}CT was determined by subtracting the ß-actin CT from the SPP1 CT for each sample assayed. Calculation of the {Delta}{Delta}CT involved using the highest {Delta}CT value as an arbitrary constant to subtract from all other {Delta}CT sample values. Fold-changes in gene expression are equivalent to 2{Delta}{Delta}CT.

In situ hybridization analysis
Spp1 mRNA was localized in paraffin-embedded mouse uterine tissue by in situ hybridization using methods described previously (Johnson et al. 1999a). Briefly, deparaffinized, rehydrated, and deproteinated uterine cross-sections (~5 µm) were hybridized with radio-labeled antisense or sense mouse Spp1 cRNA probes (Fisher et al. 1995) synthesized by in vitro transcription with [{alpha}-35S]uridine 5-triphosphate (PerkinElmer Life Sciences, Wellesley, MA, USA). After hybridization, washes, and RNase A digestion, autoradiography was performed using nuclear track material type NTB-2 liquid photographic emulsion (Eastman Kodak, Rochester, NY, USA). Slides were exposed at 4 °C for 5 days, developed in Kodak D-19 developer, counterstained with Harris’ modified hematoxylin (Fisher Scientific, Fairlawn, NJ, USA), dehydrated, and protected with cover slips.

Immunofluorescence analysis
For immunofluorescence staining of frozen sections, primary antibodies included rabbit anti-human recombinant SPP1 immunoglobulin (IgGs, LF-123 and LF-124; Fisher et al. 1995), a monoclonal mouse anti-CD45 IgG (eBioscience, San Diego, CA, USA), and a rat anti-macrophage IgG (F4/80; recognizes a 160 kDa membrane protein on mature macrophages, Hirsch & Gordon 1982). Secondary antibodies included fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (Chemicon, Temecula, CA, USA), FITC-conjugated goat anti-rat IgG (Sigma), and Alexa 594-conjugated goat anti-rabbit and goat anti-mouse IgGs (Molecular Probes, Eugene, OR, USA).

Localization of Spp1 (without co-localization with other proteins) was performed as previously described (Johnson et al. 1999b). Briefly, frozen sections (~10 µm) of uterus were cut with a cryostat (Hacker-BrightOTF, Hacker Instruments, Inc., Winnsboro, SC, USA) and mounted on Superfrost/Plus microscope slides (Fisher Scientific, Pittsburgh, PA, USA). Sections were fixed in methanol (–20 °C) for 10 min, air-dried, rehydrated at room temperature with 0.3% Tween 20 in 0.02 M PBS (rinse solution), and blocked in antibody dilution buffer (two parts 0.02 M PBS, 1.0% BSA, 0.3% Tween 20 (pH 8.0) and one part glycerol) containing 10% normal goat serum for 1 h at room temperature. Sections were then dipped in rinse solution at room temperature and incubated overnight at 4 °C with 4 µg/ml SPP1 antibody (a cocktail containing LF-123 and -124 IgGs), and detected with FITC-conjugated secondary antibody. Slides were then overlaid with a coverglass and Prolong antifade mounting reagent (Molecular Probes).

For co-localization of proteins, frozen sections of uterus were cut, mounted, fixed, permeabilized, and blocked as described above. The sections were then dipped in rinse solution at room temperature and incubated overnight at 4 °C with 2 µg/ml initial primary antibody (either anti-CD45 or anti-macrophage IgG). Following three washes in 4 °C rinsing solution for 10 min each, sections were incubated with 2 µg/ml initial secondary antibody (either FITC-conjugated anti-rat or Alexa 594-conjugated anti-mouse IgG) for 4 h at room temperature, and washed in 4 °C rinsing solution six times for 10 min each. The sections were then incubated overnight at 4 °C with 4 µg/ml second primary antibody (a cocktail containing LF-123 and -124 IgG). Following six washes in 4 °C rinsing solution for 10 min each, the sections were incubated with 2 µg/ml second secondary antibody (either FITC- or Alexa 594-conjugated anti-rabbit IgG) for 2 h at 4 °C, washed six times in 4 °C rinsing solution for 10 min each, and dipped in distilled–deionized H2O. Slides were overlaid with antifade mounting reagent as described above.

Photomicrography
Digital photomicrographs of representative bright- and dark-field images of in situ hybridization and representative fields of immunofluorescence staining were evaluated with a Zeiss Axioplan2 microscope (Carl Zeiss, Thornwood, NY, USA) fitted with an Axiocam HR digital camera. Digital images of in situ hybridization were recorded using AxioVision 3.0 or 4.3 software. For immunofluorescence co-localization of proteins, digital camera settings were evaluated to confirm that no ‘spectral bleed through’ FITC signal was detectable in the Alexa 594 filter set and vice versa. In these studies, once the distribution of individual antigens was established, the co-distribution of two antigens was investigated simultaneously in individual sections using compatible primary and FITC-or Alexa 594-secondary antibody combinations with appropriate filter sets. Individual fluorophore images were recorded sequentially with AxioVision 3.0 or 4.3 software and evaluated in multiple fluorophore overlay images recorded in the Zeiss Vision Image (ZVI) file format, which were subsequently converted to Tagged Image File (TIF) format. All in situ hybridization and immunofluorescence figures were assembled in Adobe Photoshop 7.0.1 (Adobe Systems Inc., San Jose, CA, USA). Any adjustment of brightness and/or contrast was applied uniformly to all images in a panel, and in the case of fluorescence images, to indicate the background fluorescence levels observed through the microscope.

Statistical analysis
Changes in concentrations of Spp1 mRNA were quantified by evaluating effects of reproductive status (estrus, diestrus, proestrus, days 5 and 6 of pregnancy) on the {Delta}CT from real-time RT-PCR. Changes in Spp1 mRNA were analyzed in a randomized block design using a mixed model procedure (Proc Mixed procedure; SAS Inst. Inc., Cary, NC, USA), and reproductive status was included in the model as a fixed effect. No significant treatment effects were observed.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Expression of Spp1 mRNA in cyclic and pregnant mouse uterus
In contrast to a previous report using northern blotting (Waterhouse et al. 1992), Spp1 mRNA was detected throughout the estrous cycle and through day 6 of pregnancy using the more sensitive methodology of RT-PCR (Table 1Go). However, no differences in Spp1 were evident between all days measured.


View this table:
[in this window]
[in a new window]

 
Table 1 Quantitative RT-PCR analysis of SPP1 mRNA expression in the uterus.
 
The presence of Spp1 within endometrial tissues necessitated localization of the Spp1 mRNA. In situ hybridization of mouse uterus localized Spp1 to LE and presumptive immune cells, but not to GE, stromal fibroblasts, vasculature, or myometrium. Although differences in total steady-state Spp1 mRNA were not evident by RT-PCR, changes in the distribution were clearly observed. During the estrous cycle, LE expression of Spp1 mRNA was prominent at proestrus, appeared to decrease by estrus, and was nearly undetectable at diestrus (Fig. 1Go). Spp1-expressing cells, later to be identified as immune cells (Fig. 4Go), were scattered within the stromal compartment of the endometrium throughout the estrous cycle. These cells were prominent at estrus (Fig. 1Go). During early pregnancy, Spp1 mRNA was present in endometrial immune cells similar to that observed during the estrous cycle (Fig. 2Go). However, Spp1 mRNA was not detected in LE until the evening of day 4, i.e., day 4.5 (Fig. 2Go). Expression of Spp1 mRNA in LE was transient, however, and was undetectable by day 6 of pregnancy, although immune cell expression remained prominent.


Figure 1
View larger version (189K):
[in this window]
[in a new window]

 
Figure 1 In situ hybridization analysis of Spp1 mRNA in cross-sections of mouse uteri collected from proestrus, estrus, and diestrus. The corresponding bright- and dark-field images of representative uterine cross-sections are shown. Refer to Fig. 5Go for an example of a representative negative control (Sense). Note that Spp1 mRNA is expressed in luminal epithelium (LE) and immune cells (IM), but not in glandular epithelium (GE) or stroma (ST). Width of each field, 870 µm.

 

Figure 4
View larger version (24K):
[in this window]
[in a new window]

 
Figure 4 Immunofluorescence co-localization of Spp1 with immune cell-surface markers in day 4.5 pregnant mouse frozen uterine cross-sections. (A) Spp1 immunoreactivity was detected using FITC-conjugated anti-rabbit IgG (top panel; green fluorescence), whereas the leukocyte-specific CD45 was detected using Alexa 594-conjugated anti-rat IgG (middle panel; red fluorescence). Note individual cells that exhibit both green and red fluorescent signals (bottom panel); therefore, Spp1 is expressed in a subset of endometrial immune cells. Width of fields is 140 µm. (B) Spp1 immunoreactivity was detected using Alexa 594-conjugated anti-rabbit IgG (top panel; red fluorescence), whereas the macrophage-specific F4/80 IgG was detected using FITC-conjugated anti-rat IgG (middle panel; green fluorescence). The identity of individual immunoreactive immune cells was confirmed by phase contrast microscopy to identify nuclear structures (data not shown). Yellow immunofluorescence indicates co-localization of Spp1 with macrophages (bottom panel). Spp1 is expressed in a subset of endometrial macrophages (indicated by arrows). LE, luminal epithelium. Width offields of (A) is 140 µm. Width offields of (B) is 540 µm.

 

Figure 2
View larger version (88K):
[in this window]
[in a new window]

 
Figure 2 In situ hybridization analysis of Spp1 mRNA in cross-sections of mouse uteri collected from days 4 (day 4 morning), 4.5 (day 4 evening), 5, and 6 of pregnancy. The corresponding bright- and dark-field images of representative uterine cross-sections are shown. Refer to Fig. 5Go for an example of a representative negative control (Sense). The panels in the third and fifth rows are higher magnification images of the cross-sectional region within the box inserts of the panels directly above them. Note that Spp1 mRNA is expressed in immune cells (IM), but not induced in luminal epithelium (LE) until day 4.5 (arrows indicate the presence or absence of LE expression of Spp1). St, stroma. Width fields of top four panels, 870 µm. Width of fields of panels in third row, 334 µm.

 
Localization of Spp1 protein in pregnant mouse uterus
Consistent with in situ hybridization results, immunoreactive Spp1 was prominent at the apical LE surface by day 5 of pregnancy (Fig. 3Go). In addition, Spp1 protein was localized in a pattern consistent with immune cells scattered within the endometrial stroma (Fig. 3Go).


Figure 3
View larger version (11K):
[in this window]
[in a new window]

 
Figure 3 Immunofluorescence localization of Spp1 protein in frozen sections of endometrium from day 5 pregnant mice. Images in the top panels focus on selected regions of the endometrial stroma. Images in the middle panels represent cross-sections through the entire luminal surface. Tissues were immunostained using a cocktail of polyclonal rabbit anti-human Spp1 IgG (LF-123 + LF-124; Fisher et al. 1995). Note that Spp1 was present on the apical surface of LE and the surface of immune cells (for reference of immune cell location within entire uterine cross-sections, please refer to Figs 1Go and 2Go). Rabbit IgG (rIgG) serves as a negative control. Width of fields of panels in left column, 540 µm. Width of fields of panels in right column, 220 µm.

 
Initial characterization of Spp1-expressing endometrial immune cells
Numerous cells scattered within the endometrium of pregnant mice showed positive immunostaining for Spp1 (Fig. 4AGo, top panel). In the same uterine cross-sections, similar cells immunoreacted with antiserum to the leukocyte-specific cell-surface marker CD45 (Fig. 4AGo, middle panel). When Spp1 (FITC conjugate) and CD45 (Alexa 594 conjugate) images were merged, individual cells within the same uterine cross-sections exhibited both Spp1 and CD45 immunoreactivity (Fig. 4AGo, bottom panel). All cells that stained strongly for Spp1 also expressed CD45; however, only a subset of CD45 cells expressed Spp1 (Fig. 4AGo).

Co-localization of immunostaining using anti-Spp1 LF-123/LF-124 and anti-macrophage F4/80 antisera showed that Spp1 was detectable in a subpopulation of endometrial macrophages (Fig. 4BGo). Whereas Spp1 was present in immune cells as well as at the apical surface of LE, macrophage immunoreactivity was limited to cells scattered within the endometrial stroma (Fig. 4BGo, top and middle panels). When Spp1 (Alexa 594 conjugate) and F4/80 (FITC conjugate) images were merged, the yellow fluorescence signal revealed the presence of Spp1 protein expression by some, but not all, macrophages (Fig. 4BGo, bottom panel).

Regulation of Spp1 in luminal epithelium by estrogen
Since both progesterone and estrogen play a role in regulating uterine receptivity for implantation, we examined whether these steroids differentially regulate the expression of Spp1 in the uterus. In ovariectomized mice, exogenous estrogen induced Spp1 mRNA expression in the uterine LE (Fig. 5Go). By contrast, progesterone was not effective in inducing uterine Spp1 expression (Fig. 5Go). Interestingly, co-treatment of ovariectomized mice with both estrogen and progesterone did not induce Spp1 expression in LE (Fig. 5Go). No changes were observed in the distribution of Spp1-positive immune cells with hormone treatment.


Figure 5
View larger version (104K):
[in this window]
[in a new window]

 
Figure 5 In situ hybridization analysis of Spp1 mRNA in cross-sections of mouse uteri collected from ovariectomized mice treated with sesame oil, estrogen, progesterone, or a combination of these steroids (estrogen + progesterone). The corresponding bright- and dark-field images of representative cross-sections of endometrium are shown. Note that estrogen treatment induced Spp1 mRNA expression in the endometrial luminal epithelium (LE). ST, endometrial stroma. Width of fields, 870 µm.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Spp1 at the placental–endometrial interface
There is mounting evidence from studies in several species to support the hypothesis that SPP1, secreted by uterine epithelium, provides a substrate for integrin-mediated interactions at the conceptus–maternal interface (Johnson et al. 1999a, 1999b, Apparao et al. 2001, 2003, von Wolff et al. 2001). In each of these species, pregnancy-specific SPP1 expression in endometrial epithelium has been detected during the peri-implantation period. Although SPP1 protein is evident on the conceptus trophectoderm and the apical surface of endometrial LE, SPP1 is not synthesized by the conceptus trophectoderm in these species. The presence of SPP1 at this interface suggests an interaction with membrane-bound receptors on these respective tissues. It is noteworthy that previous reports have not implicated Spp1 as a mediator of implantation in mice (Waterhouse et al. 1992, Liaw et al. 1998). First, Spp1 initially escaped detection in mouse uterus between days 1 and 8 of pregnancy (Waterhouse et al. 1992). Secondly, no reproductive phenotype was detected during initial examination of mice with targeted disruption of the Spp1 gene (Liaw et al. 1998). Therefore, Spp1 has received only perfunctory interest with regard to the attachment of mouse blastocysts to uterine LE. However, recent publication of a highly provocative reproductive phenotype in Spp1-deficient mice identified peri-implantation defects (Weintraub et al. 2004). It was demonstrated that 72% of Spp1+/+mice with a verified copulatory plug were gravid on day 10.5 of gestation as compared with 38.5% of mice with some degree of disruption of the Spp1 gene. Further, litter sizes on 10.5, 15.5, and 19.5 days of gestation showed no effect of genotype on the number of embryos within mice that remained pregnant (Weintraub et al. 2004). A reasonable interpretation of these results is that disruption of the Spp1 gene leads to an incompletely penetrant, ‘all-or-nothing’ interference with either conception, implantation or the maintenance of gestation (Weintraub et al. 2004). Results reported here, for the first time, provide strong evidence that Spp1 is temporally and spatially localized within the pregnant mouse uterus to influence early events of implantation. These results show that Spp1 mRNA is transiently induced by estrogen in the endometrial LE of pregnant mice during the attachment phase of implantation, and that Spp1 protein is prominent at the apical LE surface. Therefore, if timing and location are key to physiological function in in vivo systems, then Spp1 is now an excellent candidate gene for roles during the initial stages of mouse implantation.

In mice, ovarian progesterone and estrogen are crucial to render the uterus receptive to blastocyst implantation. These hormones act in a coordinated manner to temporally regulate proliferation and/or differentiation of specific cell types within the uterus. Preovulatory estrogen drives proliferation of epithelial cells. Rising concentrations of progesterone from the corpus luteum (CL) induce cell proliferation within the stromal compartment. Ovarian secretion of estrogen on the morning of day 4 of pregnancy, or nidatory estrogen, acts within this progestinized environment to further support proliferation, while inducing LE to stop proliferating and begin differentiating into a functionally mature surface capable of responding to signals from the conceptus with the implantation reaction (Carson et al. 2000, Dey et al. 2004, Armant 2005). The results of the present investigation establish that estrogen regulates expression of Spp1 in mouse uterine LE. Although estrogen induction of Spp1 in LE during the peri-implantation period has previously been reported in pigs, the source of estrogen appears to be different between these species (White et al. 2005). Whereas porcine SPP1 expression in LE is a uterine response to estrogen secreted by elongating pig conceptuses for pregnancy recognition, in mice, temporal changes in LE expression during the estrous cycle and pregnancy are likely the result of ovarian estrogen. Spp1 mRNA is high in LE during proestrus when high concentrations of estrogen are unopposed by high concentrations of progesterone, in ovariectomized mice given exogenous estrogen, and in pregnant mice after the nidatory estrogen surge. As such, Spp1 can be grouped with lactoferrin and heparin-binding epidermal growth factor-like growth factor (HB-EGF) as prominent glycoproteins that increase in uterine LE in response to estrogen during the mouse peri-implantation period (Mc Master et al. 1992, Das et al. 1994, Wang et al. 1994).

The similarity of expression patterns between Spp1 and HB-EGF is particularly striking. For both the genes, there is a transient rise in expression within the uterine LE during the attachment phase of implantation. Expression is induced by administration of estrogen to ovariectomized mice, whereas no expression is observed with simultaneous estrogen and progesterone treatment (Wang et al. 1994). In contrast, although pregnancy is characterized by high concentrations of progesterone, the nidatory estrogen surge stimulates expression of both Spp1 and HB-EGF in LE (Das et al. 1994). Further, HB-EGF is not present in LE during progesterone-maintained delayed implantation, but is evident after activation of the blastocyst by estrogen injection (Das et al. 1994). Therefore, it is likely that the blastocyst influences LE expression of Spp1. The present data suggests that Spp1 expression in LE requires communication between an activated blastocyst and a uterus that is becoming implantation-receptive.

The potential for endometrial epithelial Spp1 to influence conceptus–maternal interactions is significant because the Arg-Gly-Asp (RGD) and other integrin-binding sequences of Spp1 interact with several high-affinity binding partners, including {alpha}vß3, {alpha}vß1, {alpha}vß5, {alpha}4ß1, {alpha}8ß1, and {alpha}9ß1 integrins (Hu et al. 1995a, 1995b, Denda et al. 1998, Smith & Giachelli 1998, Bayless & Davis 2001). A substantial body of work in the 1990s established that transient endometrial expression of {alpha}vß3 and {alpha}4ß1 integrins is cycle-dependent, and defines the window of implantation in women (Lessey et al. 1994), and that altered expression of these integrins correlates with several conditions associated with human infertility (Lessey et al. 1992, 1995). In livestock animals, multiple integrins have regulated and/or constituted expression at the apical surface of LE during the peri-implantation period (Bowen et al. 1996, Johnson et al. 2001).

Several RGD-containing integrins are also common features of pre- and peri-implantation blastocysts in mice. In mouse blastocysts, {alpha}vß3 (often referred to as the Spp1 receptor) is present at the apical surface of trophectoderm cells, whereas {alpha}5ß1 and {alpha}llbß3 fibronectin receptors are localized intracellularly or at the basal surface of trophectoderm until integrin ligation promotes trafficking of {alpha}5ß1 and {alpha}llbß3 to strengthen fibronectin binding (Rout et al. 2004, Armant 2005). In mice, null mutations of {alpha}v, {alpha}5, ß1, or ß5 integrin genes result in peri-implantation lethality and failure of chorio-allantoic membrane fusion, and functional blockade of {alpha}v and ß3 integrins in mice and rabbits reduces the number of implantation sites (Hynes 1996, Illera et al. 2000, 2003). While a clear role for {alpha}vß3 in mouse implantation has not been defined, it is possible that its ligation, perhaps to luminal Spp1, leads to apical translocation of {alpha}5ß1 for stable conceptus attachment through fibronectin (Sutherland et al. 1993, Wang et al. 2000, Armant 2005). Indeed, {alpha}vß3, {alpha}5ß1, and {alpha}IIbß3 appear in focal adhesions formed in trophoblast cells during outgrowth on fibronectin (Sutherland et al. 1993, Yelian et al. 1995, Wang et al. 2000). Further, trophoblast binding is attenuated by antibodies to the subunits {alpha}v and ß3 (Schultz & Armant 1995, Illera et al. 2000, 2003, Rout et al. 2004). Finally, it appears that unoccupied {alpha}vß3 transmits a positive cellular death signal and ligand interaction with this integrin protects cells from apoptosis (Zhao et al. 2005).

In addition to indirect effects on implantation, Spp1 may directly modulate conceptus cell proliferation, migration, survival, and attachment in mice (Standal et al. 2004). Both cell proliferation and apoptosis, which profoundly impact conceptus development during the peri-implantation period, are influenced by Spp1 (Khan et al. 2002, Celetti et al. 2005, Caers et al. 2006). Further, it is well documented that Spp1 binds integrins to influence cell attachment and migration (Senger & Perruzzi 1996, Smith & Giachelli 1998, Al–Shamiri et al. 2005, Celetti et al. 2005, Kolb et al. 2005, Caers et al. 2006). In addition, due to its flexible nature in solution and the prominence of polymerized Spp1 cross-linked by tissue transglutaminase, self-assembly of protein complexes to expose multiple RGD sequences for simultaneous interaction with integrins on trophectoderm and LE to bridge conceptus to uterus is highly plausible (Fisher et al. 2001, Goldsmith et al. 2002). A model summarizing the present working hypothesis for the role of mouse uterine LE Spp1 during implantation is presented in Fig. 6Go.


Figure 6
View larger version (37K):
[in this window]
[in a new window]

 
Figure 6 Proposed model for roles of Spp1 in mediating trophectoderm and endometrial interactions. The drawing is an adaptation of that used by Guillomot et al.(1993). Implantation in mice depends upon synchronized development of the embryo, so that it is competent to implant, and the uterus, so that it is receptive to embryo attachment, growth, and implantation. Ovarian estrogen (E2) and progesterone (P4) advance the pre-receptive uterus to the receptive state. Reciprocal signaling between the uterus and the embryo activate the embryo to become implantation competent. A result of the embryo–uterine communication is the induction of Spp1 in the uterine luminal epithelium (LE) after the nidatory surge of E2 at initial sites of embryo trophectoderm attachment to the uterine LE for implantation. Spp1 is then secreted from LE where it can bind integrin receptors on trophectoderm and/or LE to hypothetically: (1) bridge embryo to uterus during the transient phase of attachment for implantation, (2) initiate trafficking of {alpha}5ß1 and {alpha}IIbß3 integrins to strengthen embryo fibronectin binding, (3) inhibit embryonic apoptotic cell death, and (4) mediate embryo cell proliferation and migration essential for successful invasion of the uterine wall. Spp1 is also expressed by macrophages embedded within the stroma of both cyclic and pregnant mice. This Spp1 may contribute to the extensive endometrial remodeling that the uterus undergoes during the estrous cycle and early pregnancy.

 
Spp1 in endometrial immune cells
Despite previous speculation that localization of Spp1 mRNA and protein to cells scattered within the endometrial stroma of sheep and pigs indicates production by immune cells (Johnson et al. 1999a, 2003b), results of the present study are the first to definitively localize immune cells that produce Spp1 within the peri-implantation endometrium of any species. The detection of a subpopulation of cells that express both CD45 and Spp1 agrees with a previous report of CD45-positive leukocyte isolation from human endometrium (von Wolff et al. 2001), and our results further suggest that, in mouse endometrium, at least some of these CD45-positive cells are a subset of macrophages. Certainly Spp1, also known as early T-lymphocyte activation factor-1, is an established component of the immune system. Reports of Spp1 activity in the immune system actually preceded its identification in malignant transformed cells and bone, Spp1 was later isolated independently from T-cells where it was the most abundantly increased gene in response to conconava-lin-A treatment (Patarca et al. 1989). Spp1, associated with activated T-lymphocytes (Patarca et al. 1989, O’Regan et al. 1999), is strongly expressed by monocytes and macrophages (Takahashi et al. 2004), and is present in neutrophils (Ueno et al. 2001). It is not surprising that macrophages were identified in these studies. Activated macrophages are major cellular components of the uterus, the placenta, and the extraembryonic membranes that are capable of synthesizing and secreting a wide array of cytokines throughout pregnancy (Hunt 1990). Clearly, Spp1 is one of the products of activated macrophages within endometrial tissues. Although the expression of Spp1 by these multi-functional cells likely contributes to endometrial remodeling for implantation and placentation, at present, speculation for a specific role for Spp1 as a component of the endometrial immune system would be premature. However, it is generally accepted that macrophages are central to intricate hormone–prostaglandin–cytokine networks that regulate development within the pregnant uterus (Hunt 1990). In this context, Spp1 is a potentially powerful player. Immune cell Spp1 has roles in the maintenance and the remodeling of tissue during inflammation, where it mediates cell–cell and cell–ECM communication resulting in targeted chemotaxis of immune cells (Weber & Cantor 1996). In vitro, Spp1 can induce migration of both T-cells and macrophages (Patarca et al. 1989, Yamamoto et al. 1995), and in vivo infiltration of macrophages towards Spp1 injected into rat dermis has been observed (Giachelli et al. 1998). Importantly, Spp1 induces chemotactic migration of dendritic cells from the skin to the draining lymph nodes, a process required for many inflammatory responses (Weiss et al. 2001). Recently, Spp1 was shown to be a key component of Typ-1 (Th-1) immunity that upregulates interleukin (IL)-12 and downregulates IL-10 expression by macrophages and monocytes (Ashkar et al. 2000). Although beyond the scope of this initial investigation, future studies to carefully quantify both the percentage of each immune cell type that is positive for Spp1, as well as to document their temporal and spatial localization within the uterus during mouse pregnancy are warranted.

In conclusion, the hormonal regulation and exquisite temporal/spatial distribution of Spp1 at the apical surface of uterine LE during conceptus apposition provides a mechanism for Spp1 to bridge conceptus trophectoderm to uterine LE during the attachment period of implantation. Further, the presence of Spp1-positive macrophages within the underlying endometrial stroma suggests a role for Spp1 during remodeling of uterine tissue for conceptus invasion. The recent report showing that 49% of fewer Spp1 null mice maintain pregnancy through mid-gestation than wild-type counterparts yet show no difference in the numbers of implantation sites within mice that remain pregnant indicates that the loss of Spp1 at the maternal/fetal interface can be compensated for by other factors, but in half of the mice, disruption is severe enough to produce peri-implantation pregnancy failure. If pregnancy is maintained through this initial critical period, placentation proceeds in a grossly normal manner (Weintraub et al. 2004). The conserved expression pattern for SPP1 between humans, sheep, rabbits, and now mice adds considerable credibility to this idea (Johnson et al. 1999a, 1999b, Apparao et al. 2001, 2003, von Wolff et al. 2001). Results shown here significantly extend the physiological implications of Spp1 to mouse pregnancy, and should catalyze the future development of studies that focus on the mechanistic nature of functions of this component of the uterine/placental environment using the powerful genetic mouse model.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
The authors thank Dr Larry W. Fisher of the National Institutes of Health for the mouse Spp1 cDNA, and for rabbit polyclonal LF-123 and LF-124 to recombinant human SPP1. This work was supported in part by NIH Grant P30ES0910607. The authors declare that there is no conflict of interest that would prejudice the impartiality of this scientific work.


    Footnotes
 
Received 15 June 2006
First decision 20 July 2006
Accepted 1 September 2006


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 

Al-Shamiri R, Sorensen ES, Ek-Rylander B, Andersson G, Carson DD & Farach-Carson MC 2005 Phosphorylated osteopontin promotes migration of human choriocarcinoma cells via a p70 S6 kinase-dependent pathway. Journal of Cellular Biochemistry 94 1218–1233.[CrossRef][ISI][Medline]

Apparao KB, Murray MJ, Fritz MA, Meyer WR, Chambers AF, Truong PR & Lessey BA 2001 Osteopontin and its receptor alpha(9)beta(3) integrin are coexpressed in the human endometrium during the menstrual cycle but regulated differentially. Journal of Clinical Endocrinology and Metabolism 86 4991–5000.[Abstract/Free Full Text]

Apparao KB, Illera MJ, Beyler SA, Olson GE, Osteen KG, Corjay MH, Boggess K & Lessey BA 2003 Regulated expression of osteopontin in the peri-implantation rabbit uterus. Biology of Reproduction 68 1484–1490.[Abstract/Free Full Text]

Armant DR 2005 Blastocyts don’t go it alone. Extrinsic signals fine-tune the intrinsic developmental program of trophoblast cells. Developmental Biology 280 260–280.[CrossRef][ISI][Medline]

Ashkar S, Weber GF, Panoutsakopoulou V, Sanchirico ME, Jansson M, Zawaideh S, Rittling SR, Denhardt DT, Glimcher MJ & Cantor H 2000 Eta-1 (osteopontin): an early component of type-1 (cell-mediated) immunity. Science 287 860–865.[Abstract/Free Full Text]

Bayless KJ & Davis GE 2001 Identification of dual alpha 4beta1 integrin binding sites within a 38 amino acid domain in the N-terminal thrombin fragment of human osteopontin. Journal of Biological Chemistry 276 13483–13489.[Abstract/Free Full Text]

Bowen JA, Bazer FW & Burghardt RC 1996 Spatial and temporal analyses of integrin and Muc-1 expression in porcine uterine epithelium and trophectoderm in vivo. Biology of Reproduction 55 1098–1106.[Abstract]

Butler WT, Ridall AL & McKee MD 1996 Osteopontin. In Principles of Bone Biology, pp 167–181. New York: Academic Press Inc.

Caers J, Gunthert U, Raeve H, Valckenborgh EV, Menu E, Riet IV, Camp BV & Vanderkerken K 2006 The involvement of osteopontin and its receptors in multiple myeloma cell survival, migration and invasion in the mouse 5T33MM model. British Journal of Haematology 132 469–477.[ISI][Medline]

Carson DD, Bagchi I, Dey SK, Enders AC, Fazleabas AT, Lessey BA & Yoshinaga K 2000 Embryo implantation. Developmental Biology 223 217–237.[CrossRef][ISI][Medline]

Carson DD, Lagow E, Thathiah A, Al-Shami R, Farach-Carson MC, Vernon M, Yuan L, Fritz MA & Lessey B 2002 Changes in gene expression during the early to mid-luteal (receptive phase) transition in human endometrium detected by high-density microarray screening. Molecular Human Reproduction 8 871–879.[Abstract/Free Full Text]

Celetti A, Testa D, Staibano S, Merolla F, Guarino V, Castellone MD, Iovine R, Mansueto G, Somma P, De Rosa G, Galli V, Melillo RM & Santoro M 2005 Overexpression of the cytokine osteopontin identifies aggressive laryngeal squamous cell carcinomas and enhances carcinoma cell proliferation and invasiveness. Clinical Cancer Research 11 8019–8027.[Abstract/Free Full Text]

Das DK, Wang XN, Paria BC, Damm D, Abraham JA, Klagsbrun M, Andrews GK & Dey SK 1994 Heparin-binding EGF-like growth factor gene is induced in the mouse uterus temporally by the blastocyst solely at the site of its apposition: a possible ligand for interaction with blastocyst EGF-receptor in implantation. Development 120 1071–1083.[Abstract]

Denda S, Reichardt LF & Muller U 1998 Identification of osteopontin as a novel ligand for the integrin alpha8 beta1 and potential roles for this integrin-ligand interaction in kidney morphogenesis. Molecular Biology of the Cell 9 1425–1435.[Abstract/Free Full Text]

Denhardt DT, Noda M, O’Regan AW, Pavlin D & Berman JS 2003 Osteopontin as a means to cope with environmental insults: regulation of inflammation, tissue remodeling, and cell survival. Journal of Clinical Investigation 107 1055–1061.

Dey SK, Lim H, Das SK, Reese J, Paria BC, Daikoku T & Wang H 2004 Molecular cues to implantation. Endocrine Reviews 25 341–373.[Abstract/Free Full Text]

Fisher LW, Stubbs JT III & Young MF 1995 Antisera and cDNA probes to human and certain animal model bone matrix noncollagenous proteins. Acta Orthopaedica Scandinavica–Supplementum 266 61–65.

Fisher LW, Torchia DA, Fohr B, Young MF & Fedarko NS 2001 Flexible structures of SIBLING proteins, bone sialoprotein, and osteopontin. Biochemical and Biophysical Research Communications 280 460–465.[CrossRef][ISI][Medline]

Giachelli CM & Steitz S 2000 Osteopontin: a versatile regulator of inflammation and biomineralization. Matrix Biology 19 615–622.[CrossRef][ISI][Medline]

Giachelli CM, Lombardi D, Johnson RJ, Murry CE & Almeida M 1998 Evidence for a role of osteopontin in macrophage infiltration in response to pathological stimuli in vivo. American Journal of Pathology 152 353–358.[Abstract]

Goldsmith HL, Labrosse JM, McIntosh FA, Maenpaa PH, Kaartinen MT & McKee MD 2002 Homotypic interactions of soluble and immobilized osteopontin. Annals of Biomedical Engineering 30 840–850.[CrossRef][ISI][Medline]

Guillomot M, Flechon JE & Leroy F 1993 Blastocyst development an implantation. In Reproduction in Mammals and Man, pp 387–411. Eds C Thibault, MC Levasseur & RHS Hunter. Paris: Elysses.

Hirsch S & Gordon S 1982 The use and limitation of monoclonal antibodies against monuclear phagocytes. Immunobiology 161 298–307.[ISI][Medline]

Hu DD, Hoyer JR & Smith JW 1995a Ca2+suppresses cell adhesion to osteopontin by attenuating binding affinity for integrin alpha v beta 3. Journal of Biological Chemistry 270 9917–9925.[Abstract/Free Full Text]

Hu DD, Lin EC, Kovach NL, Hoyer JR & Smith JW 1995b A biochemical characterization of the binding of osteopontin to integrins alpha v beta 1 and alpha v beta 5. Journal of Biological Chemistry 270 26232–26238.[Abstract/Free Full Text]

Hunt JS 1990 Current topic: the role of macrophages in the uterine response to pregnancy. Placenta 11 467–475.[CrossRef][ISI][Medline]

Hynes RO 1996 Targeted mutations in cell adhesion genes: what have we learned from them? Developmental Biology 180 402–412.[CrossRef][ISI][Medline]

Illera MJ, Cullinan E, Gui Y, Yuan L, Beyler SA & Lessey BA 2000 Blockade of the alpha(v)beta(3) integrin adversely affects implantation in the mouse. Biology of Reproduction 62 1285–1290.[Abstract/Free Full Text]

Illera MJ, Lorenzo PL, Gui YT, Beyler SA, Apparao KB & Lessey BA 2003 A role for alphavbeta3 integrin during implantation in the rabbit model. Biology of Reproduction 68 766–771.[Abstract/Free Full Text]

Johnson GA, Spencer TE, Burghardt RC & Bazer FW 1999a Ovine osteopontin. I. Cloning and expression of messenger ribonucleic acid in the uterus during the periimplantation period. Biology of Reproduction 61 884–891.[Abstract/Free Full Text]

Johnson GA, Burghardt RC, Spencer TE, Newton GR, Ott TL & Bazer FW 1999b Ovine osteopontin. II. Osteopontin and alpha(v)-beta(3) integrin expression in the uterus and conceptus during the periimplantation period. Biology of Reproduction 61 892–899.[Abstract/Free Full Text]

Johnson GA, Bazer FW, Jaeger LA, Ka H, Garlow JE, Pfarrer C, Spencer TE & Burghardt RC 2001 Muc-1, integrin, and osteopontin expression during the implantation cascade in sheep. Biology of Reproduction 65 820–828.[Abstract/Free Full Text]

Johnson GA, Burghardt RC, Joyce MM, Spencer TE, Bazer FW, Gray CA & Pfarrer C 2003a Osteopontin is synthesized by uterine glands and a 45-kDa cleavage fragment is localized at the uterine-placental interface throughout ovine pregnancy. Biology of Reproduction 69 92–98.[Abstract/Free Full Text]

Johnson GA, Burghardt RC, Bazer FW & Spencer TE 2003b Osteopontin: roles in implantation and placentation. Biology of Reproduction 69 1458–1471.[Abstract/Free Full Text]

Kao LC, Tulac S, Lobo S, Imani B, Yang JP, Germeyer A, Osteen K, Taylor RN, Lessey BA & Giudice LC 2002 Global gene profiling in human endometrium during the window of implantation. Endocrinology 143 2119–2138.[Abstract/Free Full Text]

Khan SA, Lopez-Chua CA, Zhang J, Fisher LW, Sorensen ES & Denhardt DT 2002 Soluble osteopontin inhibits apoptosis of adherent endothelial cells deprived of growth factors. Journal of Cellular Biochemistry 85 728–736.[CrossRef][ISI][Medline]

Kolb A, Kleeff J, Guweidhi A, Esposito I, Giese NA, Adwan H, Giese T, Buchler MW, Berger MR & Friess H 2005 Osteopontin influences the invasivness of pancreatic cancer cells and is increased in neoplastic inflammatory conditions. Cancer Biology and Therapy 4 740–746.

Lessey BA, Damjanovich L, Coutifaris C, Castelbaum A, Albelda SM & Buck CA 1992 Integrin adhesion molecules in the human endometrium. Correlation with the normal and abnormal menstrual cycle. Journal of Clinical Investigation 90 188–195.[ISI][Medline]

Lessey BA, Castelbaum AJ, Buck CA, Lei Y, Yowell CW & Sun J 1994 Further characterization of endometrial integrins during the menstrual cycle and in pregnancy. Fertility and Sterility 62 497–506.[ISI][Medline]

Lessey BA, Castelbaum AJ, Sawin SW & Sun J 1995 Integrins as markers of uterine receptivity in women with primary unexplained infertility. Fertility and Sterility 63 535–542.[ISI][Medline]

Liaw L, Birk DE, Ballas CB, Whitsitt JS, Davidson JM & Hogan BL 1998 Altered wound healing in mice lacking a functional osteopontin gene (spp1). Journal of Clinical Investigation 101 1468–1478.[ISI][Medline]

McMaster MT, Teng CT, Dey SK & Andrews GK 1992 Lactoferrin in the mouse uterus: analyses of the preimplantation period and regulation by ovarian steroids. Molecular Endocrinology 6 101–111.[Abstract]

Mirkin S, Arslan M, Churikov D, Corica A, Diaz JI, Williams S, Bocca S & Oehninger S 2005 In search of candidate genes critically expressed in the human endometrium during the window of implantation. Human Reproduction 20 2104–2117.[Abstract/Free Full Text]

Nomura S, Wills AJ, Edwards DR, Heath JK & Hogan BL 1988 Developmental expression of 2ar (Osteopontin) and SPARC (Osteonectin) RNA as revealed by in situ hybridization. Journal of Cell Biology 106 441–449.[Abstract/Free Full Text]

Norwitz ER, Schust DJ & Fisher SJ 2001 Implantation and the survival of early pregnancy. New England Journal of Medicine 345 1400–1408.[Free Full Text]

O’Regan AW, Chupp GL, Lowry JA, Goetschkes M, Mulligan N & Berman JS 1999 Osteopontin is associated with T cells in sarcoid granulomas and has T cell adhesive and cytokine-like properties in vitro. Journal of Immunology 162 1024–1031.[Abstract/Free Full Text]

Patarca R, Freeman GJ, Singh RP, Wei FY, Durfee T, Blattner F, Ragnier DC, Kozak CA, Mock BA, Morse HC III, Jerrells TR & Cantor H 1989 Structural and functional studies of the early T lymphocyte activation 1 (ETA-1) gene. Definition of a novel T cell-dependent response associated with genetic resistance to bacterial infection. Journal of Experimental Medicine 170 145–161.[Abstract/Free Full Text]

Rout UK, Wang J, Paria BC & Armant DR 2004 Alpha5beta1, alphaVbeta3 and the platelet-associated integrin alphaIIbbeta3 coordinately regulate adhesion and migration of differentiating mouse trophoblast cells. Developmental Biology 268 135–151.[CrossRef][ISI][Medline]

Schultz JF & Armant DR 1995 Beta 1- and beta 3-class integrins mediate fibronectin binding activity at the surface of developing mouse peri-implantation blastocysts. Regulation by ligand-induced mobilization of stored receptor. Journal of Biological Chemistry 270 11522–11531.[Abstract/Free Full Text]

Senger DR & Perruzzi CA 1996 Cell migration promoted by a potent GRGDS-containing thrombin-cleavage fragment of osteopontin. Biochimica et Biophysica Acta 1314 13–24.[Medline]

Smith LL & Giachelli CM 1998 Structural requirements for alpha 9 beta 1-mediated adhesion and migration to thrombin-cleaved osteopontin. Experimental Cell Research 242 351–360.[CrossRef][ISI][Medline]

Standal T, Borset M & Sundan A 2004 Role of osteopontin in adhesion, migration, cell survival and bone remodeling. Experimental Oncology 26 179–184.[ISI][Medline]

Sutherland AE, Calarco PG & Damsky CH 1993 Developmental regulation of integrin expression at the time of implantation in the mouse embryo. Development 119 1175–1186.[Abstract]

Takahashi F, Takahashi K, Shimizu K, Cui R, Tada N, Takahashi H, Soma S, Yoshioka M & Fukuchi Y 2004 Osteopontin is strongly expressed by alveolar macrophages in the lungs of acute respiratory distress syndrome. Lung 182 173–185.[ISI][Medline]

Ueno H, Murakami M, Okumura M, Kadosawa T, Uede T & Fujinaga T 2001 Chitosan accelerates the production of osteopontin from polymorphonuclear leukocytes. Biomaterials 22 1667–1673.[CrossRef][ISI][Medline]

von Wolff M, Strowitzki T, Becker V, Zepf C, Tabibzadeh S & Thaler CJ 2001 Endometrial osteopontin, a ligand of beta3-integrin, is maximally expressed around the time of the ‘implantation window’. Fertility and Sterility 76 775–781.[CrossRef][ISI][Medline]

Wang X-N, Das SK, Damm D, Klagsbrun M, Abraham JA & Dey SK 1994 Differential regulation of heparin-binding epidermal growth factor-like growth factor in the adult ovariectomized mouse uterus by progesterone and estrogen. Endocrinology 135 1264–1271.[Abstract]

Wang J, Mayernik L, Schultz JF & Armant DR 2000 Acceleration of trophoblast differentiation by heparin-binding EGF-like growth factor is dependent on the stage-specific activation of calcium influx by ErbB receptors in developing mouse blastocysts. Development 127 33–44.[Abstract]

Waterhouse P, Parhar RS, Guo X, LaLa PK & Denhardt DT 1992 Regulated temporal and spatial expression of the calcium-binding proteins calcyclin and OPN (Osteopontin) in mouse tissues during pregnancy. Molecular Reproduction and Development 32 315–323.[CrossRef][ISI][Medline]

Weber GF & Cantor H 1996 The immunology of Eta-1/osteopontin. Cytokine and Growth Factor Reviews 7 241–248.[CrossRef][Medline]

Weintraub AS, Lin X, Itskovich VV, Aguinaldo JG, Chaplin WF, Denhardt DT & Fayad ZA 2004 Prenatal detection of embryo resorption in osteopontin-deficient mice using serial noninvasive magnetic resonance microscopy. Pediatric Research 55 419–424.[CrossRef][ISI][Medline]

Weiss JM, Renkl AC, Maier CS, Kimming M, Liaw L, Ahrens T, Kon S, Maeda M, Hotta H, Uede T & Simon JC 2001 Osteopontin is involved in the intitiation of cutaneous contact hypersensitivity by inducing Langerhans and dendritic cell migration to lymph nodes. Journal of Experimental Medicine 194 1219–1229.[Abstract/Free Full Text]

White FJ, Ross JW, Joyce MM, Geisert RP, Burghardt RC & Johnson GA 2005 Steroid regulation of cell specific secreted phosphoprotein 1 (osteopontin) expression in the pregnant porcine uterus. Biology of Reproduction 73 1294–1301.[Abstract/Free Full Text]

Yamamoto S, Nasu K, Ishida T, Setoguchi M, Higuchi H, Hijiya N & Akizuki S 1995 Effect of recombinant osteopontin on adhesion and migration of P388D1 cells. Annals of the New York Academy of Sciences 760 378–380.[ISI][Medline]

Yelian FD, Yang Y, Hirata JD, Schultz JF & Armant DR 1995 Molecular interactions between fibronectin and integrins during mouse blastocyst outgrowth. Molecular Reproduction and Development 41 435–448.[CrossRef][ISI][Medline]

Zhao H, Ross FP & Teitelbaum SL 2005 Unoccupied alpha(v)beta(3) integrin regulates osteoclast apoptosis by transmitting a positive death signal. Molecular Endocrinology 19 771–780.[Abstract/Free Full Text]


This article has been cited by other articles:


Home page
ReproductionHome page
J. L Herington and B. M Bany
The conceptus increases secreted phosphoprotein 1 gene expression in the mouse uterus during the progression of decidualization mainly due to its effects on uterine natural killer cells
Reproduction, June 1, 2007; 133(6): 1213 - 1221.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Ar