| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
RESEARCH |
Department of Biological Sciences, California State University Long Beach, Long Beach, CA 90840, USA
Correspondence: Correspondence should be addressed to K A Young; Email: kyoung4{at}csulb.edu
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The inhibitory effects of short photoperiods on the HPG axis in male Siberian hamsters are well documented (Hoffmann 1979, Bergmann 1987, Furuta et al. 1994). Within 6 days of transfer from long to short photoperiods, serum concentrations of both FSH and testosterone are reduced (Yellon & Goldman 1987, Furuta et al. 1994). In addition, exposure to (SD) lengths for 614 weeks results in significant reduction in testis mass, decline in seminiferous tubule diameter, disruption of spermatogenesis, and alterations in Sertoli and Leydig cell morphology (Bergmann 1987, Young et al. 1999). This (SD)-induced testicular regression is mediated in Siberian hamsters and white-footed mice (Peromyscus leucopus) by increased apoptotic cell death of germ cells. During regression, incidence of gonadal apoptosis is inversely proportional to declines in testis mass, and components of the apoptotic pathway are upregulated within 3 weeks of short photoperiod exposure in Siberian hamsters (Furuta et al. 1994), and within 46 weeks in white-footed-mice (Young et al. 1999). Conversely, angiogenic factors are downregulated during testicular regression induced by short days in white-footed mice (Young & Nelson 2000, Pyter et al. 2005), indicating that expression of a number of gene families may contribute to tissue transformation during gonadal regression.
While the pathways mediating testicular regression have been examined thoroughly, less is known about mediation of seasonal changes in ovarian function. Exposure of female Siberian hamsters to short photoperiod induces loss of estrous cyclicity, declines in plasma FSH concentrations, uterine atrophy, impaired folliculogenesis and, consequently, cessation of ovulation (Schlatt et al. 1993). Despite these data, the cellular and molecular mechanisms mediating the reduction in ovarian function remain unknown. If ovarian regression is mediated in a similar manner as testicular atrophy, short photoperiods may induce extensive apoptotic cell death in ovarian tissue.
Unlike the testes, where apoptosis in the reproducing adult is low (Young et al. 1999, 2001), high levels of apoptotic cell death are a fundamental component of normal adult ovarian function (Coucouvanis et al. 1993, Johnson 2003). Ultimately, the fate of over 99.9% of all oocytes is death via germ-cell attrition or follicular atresia (reviewed in Morita & Tilly 1999). In addition to germ-cell death prior to birth, follicular atresia is a normal part of each ovulatory cycle. Prior to ovulation, cohorts of follicles are recruited; however, only select follicles develop fully and ovulate. Morphologic assessments, along with in situ and gel electrophoresis analyses of DNA and apoptotic proteins, implicate apoptosis as the molecular mechanism underlying follicular atresia (Hughes & Gorospe 1991, Tilly et al. 1991, Palumbo & Yeh 1994). In addition to cell death during follicular development, apoptosis is also involved in regression of the corpus luteum at the end of the ovarian cycle (Zeleznick et al. 1989, Guo et al. 1998, Roughton et al. 1999). Among the proteins in the apoptotic cascade, active caspase-3 is consistently upregulated in granulosa cells of atretic follicles, and is considered an accurate marker of follicular apoptosis (Fenwick & Hurst 2002). Indeed, knockout studies confirm that caspase-3, an effector enzyme, is required for normal programmed cell death of granulosa cells in the ovary (Matikainen et al. 2001).
Despite the extensive research on the role of apoptosis in normal ovarian development and function, little is known about its role in the suppression of ovarian activity in seasonally breeding mammals, specifically Siberian hamsters. We hypothesized that exposing female Siberian hamsters to short (inhibitory) as opposed to long (control) photoperiods would result in early disruption of ovarian function mediated by apoptosis. In the present study, we investigated the progressive inhibitory effects of short photoperiods on Siberian hamster ovarian activity after 3, 6, 9 and 12 weeks of SD or LD exposure. Ovarian activity was determined through examination of ovarian morphology and assessing sex-steroid concentrations. In addition, the mechanism of ovarian regression was investigated, as we hypothesized that exposure to short days would increase the extent of ovarian apoptosis above that observed in LD females. The extent of apoptosis in ovarian regression was determined by both TUNEL analysis and caspase-3 immunohistochemistry.
| Materials and Methods |
|---|
|
|
|---|
RIA
After blood collection, plasma was subsequently separated by centrifugation (1500 g for 5 min) and stored at 80 °C until RIA. Plasma estradiol and progesterone concentrations were determined with the Ultra-Sensitive estradiol RIA and progesterone RIA 125I double-antibody kits (Diagnostic Systems Laboratories, Webster, TX, USA). All samples were assayed in duplicate, and their radioactivity was measured with a PerkinElmer Cobra II gamma counter (Packard Instruments, Boston, MA, USA). Values were entered into Sigma Plot software (SPSS Inc., Chicago, IL, USA), a standard curve was generated with the four-parameter logistic curve function, and the final hormone concentrations were calculated with the Sigma Plot standard curve analysis function. Assay standards and controls for both estradiol and progesterone were within the normal limits. The intra- and interassay coefficients of variation for estradiol were 6.3 and 4.7% respectively. For progesterone, they were 4.9 and 7.9% respectively. Estradiol concentration values were compared against those of the CSULB Endocrine Laboratory (Schmidt & Kelley 2001). The lower limits of detection for the estradiol and progesterone assays were 5 pg/ml and 0.1 ng/ml respectively, with low cross-reactions to other steroids: 0.642.40% and 0.885.0% respectively.
Follicle counting
The effect of inhibitory photoperiods on ovarian activity was assessed by histologic examination. Tissues were deparaffinized in xylene, rehydrated through a graded series of ethanols, washed in PBS and then stained with hematoxylin and eosin. A minimal number of sections that contained fewer than four ovarian structures were excluded from the assessment. Ovarian structures were grouped and counted according to the following classifications:
Hamsters (n = 3) whose ovarian histology revealed corpora lutea after 12 weeks of SD exposure were identified as nonresponders and were eliminated from this study. To avoid double counting, only follicles with a visible oocyte were counted, or adjacent sections were considered when structures lacking oocytes, such as corpus luteum, were counted. An observer blind to photoperiod and weeks in treatment verified follicle counts. For each ovary, the average number of each ovarian structure per section was determined from the six sections counted per animal.
TUNEL assay
Apoptotic activity was assessed by the in situ terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end-labeling (TUNEL) technique with the TACS 2TdT Blue Label kit (Trevigen, Gaithersburg, MD, USA). The experiment was conducted in accordance with the protocol supplied by the manufacture. Positive control sections were pretreated with TACS-Nuclease, to induce DNA fragmentation before the TUNEL reaction. Negative controls were processed in the absence of the TdT enzyme and showed no staining. After labeling, sections were examined with brightfield illumination. Follicles with at least five labeled cells were considered TUNEL positive. For each ovary, the average number of TUNEL-positive follicles per section was determined from the six sections counted per animal.
Caspase-3 immunostaining
To assess apoptotic cell death further, the effector enzyme, active caspase-3, was analyzed by immunohistochemistry. For caspase-3 immunostaining, six representative ovarian tissue sections per animal were deparaffinized in xylene, rehydrated in ethanol solutions and rinsed in PBS. To facilitate antigen retrieval, sections were treated with Antigen Unmasking Solution (Vector Laboratories, Burlingame, CA, USA) and heated in a pressure cooker for 10 min. Endogenous peroxidases were quenched in a 3% H2O2/-methanol solution. After 40-min blocking with a 1:20 solution of normal goat serum to PBS/Tween 20, sections were incubated overnight at room temperature in a 1:125 dilution of anti-human/mouse active caspase-3 antibody (R&D Systems, Minneapolis, MN, USA). The sections were rinsed in PBS, and then incubated for 45 min at room temperature with a biotinylated goat anti-rabbit immunoglobulin G secondary antibody (1:200; Vector Laboratories). Immediately after incubation with the secondary antibody, sections were incubated for 30 min at room temperature with avidin-biotin-peroxidase solution (Vectastain elite ABC kit; Vector Laboratories). The antigen was visualized with the NovaRed Substrate kit (Vector Laboratories) and counterstained with hematoxylin. Negative control sections were processed in the absence of the active caspase-3 primary antibody and showed no staining. Follicles with at least five intensely labeled cells were considered active caspase-3 positive; diffuse staining was not quantified. For each ovary, the average number of active caspase-3-positive follicles per section was determined from the six sections counted.
Caspase-3 PCR analysis
In addition to caspase-3 immunolabeling, relative levels of caspase-3 mRNA were assessed in all hamsters. After all tissue collection, total RNA was isolated from the frozen contralateral ovaries with TRIzol reagent (Invitrogen) according to the Invitrogen standard protocol. For all samples that contained sufficient RNA (five week-12 SD samples were removed from further analysis due to inadequate concentrations of RNA), reverse transcription was carried out on 1 µg DNase (Promega)-treated RNA with Molony murine leukemia virus reverse transcriptase (Promega) and random hexamer primers for 2 h at 37 °C. For the semiquantitative PCR, primer concentration, cycle number and optimal temperature were determined empirically. Reactions were conducted at 94 °C for 30 s, annealing at 57 °C for 1 min, and extension at 72 °C for 1 min for 32 (caspase-3) or 25 (ß-actin) cycles. Primer sequences for caspase-3 were as follows: forward, GGAGCAGCTTTGTGTGTGTGATTC; reverse, TCCATCCTTTG-ACTCTGCTCATGG. Primer sequences for the internal standard, ß-actin were as follows: forward, AGGGTGTG-ATGGTGGGAA; reverse, CATCTGCTGGAAGGTGGA. For each hamster, 10 µl of PCR product was electrophoresed through a 2% agarose gel containing 1 µl ethidium bromide to allow visualization. Gels were visualized with the Gel Doc XR documentation system (BioRad, Hercules, CA, USA), and density of bands was analyzed with Quantity One software (Discovery Series, BioRad). For each hamster, the optical density of the caspase-3 band was normalized by division by density of the standard ß-actin band to obtain the relative mRNA expression for caspase-3.
Statistical evaluation of data
All results are presented as the mean ± S.E.M. All data were analyzed by one-way ANOVA with the significance level set at 0.05, using the Prism 4 statistical software package (GraphPad Software, San Diego, CA, USA). In cases of unequal variances among groups, data were square-root transformed prior to ANOVA, with the exception of the atretic follicle count, which was log transformed to normalize data. To isolate significant differences between groups, the StudentNewmanKeuls post-hoc test was used for all pairwise comparisons.
| Results |
|---|
|
|
|---|
Body mass and reproductive organ masses
No significant difference existed between body masses of LD and SD hamsters despite an apparent trend toward a decreased body mass in SD hamsters (P > 0.05) (Table 1
). Paired ovary mass declined twofold in SD hamsters by week 12 of photoperiod exposure compared with LD females (P < 0.05) (Table 1
). A 1.4-fold reduction in uterine mass was first observed within 3 weeks of SD photoperiod treatment; by 12 weeks, continued SD exposure further reduced uterine mass by 3.5-fold as compared with LD controls (P < 0.05) (Table 1
).
|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
A rapid increase in follicular death, as determined by TUNEL staining and active caspase-3 immunolabeling/mRNA expression, was observed in SD ovaries within 3 weeks of SD exposure. These findings all corroborate a relatively rapid induction of increased ovarian apoptotic cell death, and implicate apoptosis as an initial process in SD-induced ovarian regression. Our observations in the female Siberian hamster are consistent with those in the male Siberian hamster, in which testicular apoptosis is significantly elevated during the first 3 weeks of SD exposure (Furuta et al. 1994).
The general pattern of caspase-3 mRNA expression levels mirrored that of active caspase-3 immunostaining; however, week-3 SD caspase-3 mRNA expression was not significantly higher than levels observed in week-12 SD individuals. This discrepancy is probably due to the reduced number of samples available for RNA analysis in the week-12 SD group. Ovaries from this group were extremely small, and we were not able to extract sufficient quantities of mRNA from five of these ovaries. The samples that were successfully processed represented the larger ovaries from that week; therefore, caspase-3 may still be upregulated slightly in this modified group.
The early onset of follicular apoptosis observed in the present study occurs in the absence of a decline in diestrus II estradiol concentrations; significant reductions in estradiol concentrations were not detected until week 9 of SD exposure. Therefore, estradiol withdrawal does not appear to be an initiating factor in SD-induced apoptotic activity. Instead, declines in circulating FSH are probably responsible for this early onset of gonadal apoptosis. In both peripubertal and adult male Siberian hamsters, a significant decline in plasma FSH is observed within 7 days of short photoperiod exposure (Yellon & Goldman 1987, Furtua et al. 1994). Furthermore, reductions in FSH concentrations are immediately followed by increases in testicular apoptotic DNA fragmentation in peripubertal male Siberian hamsters (Furtua et al. 1994). Although the first significant drop in FSH reportedly occurs at 6-week SD exposure in female Siberian hamsters (Schlatt et al. 1993), evidence suggests that even slight declines in FSH may be sufficient to induce follicular cell death (Uilenbroek et al. 1980). Alternatively, additional factors may trigger SD-induced gonadal apoptosis. LH acts a survival factor, particularly for preovulatory follicles (Braw & Tsafriri 1980); however, SD exposure reduces serum concentrations of LH in female Siberian hamsters (Dodge & Badura 2002a). In female Syrian hamsters (Mesocricetus aureus), SD exposure reduces circulating concentrations of IGF-I, which is also a survival factor in the ovary (Vaughan et al. 1994, Chun et al. 1996, Hsueh et al. 1996).
Analysis of ovarian histology revealed that short photoperiods had a detrimental effect on folliculogenesis. By 12 weeks of SD exposure, the number of preantral follicles declined significantly, which is consistent with the observation that most TUNEL-positive follicles are late preantral follicles. The number of early antral/antral follicles in ovaries from hamsters exposed to 3, 6 and 9 weeks of SD lengths was consistent with that observed in LD ovaries. Interestingly, despite the presence of early antral/antral follicles in hamsters exposed to 6 and 9 weeks of SD lengths, plasma concentrations of estradiol, predominately synthesized and secreted from early antral/antral follicles, were reduced. This suggests that the steroidogenic pathway was impaired in early antral/antral follicles present in week-6 and -9 SD ovaries, despite not appearing atretic or labeling positively for either TUNEL or active caspase-3.
In contrast to the significant decrease in estradiol concentrations between LD and SD hamsters, no significant differences in plasma progesterone concentrations were noted between the photoperiod groups. It is possible that the lack of difference in progesterone concentrations can be attributed to diestrus II-specific tissue collection, as progesterone concentrations are low at this point in the estrous cycle (Wynne-Edwards et al. 1987, Reburn et al. 1996). Diestrus II was selected since the vaginal cytology of acyclic photoperiod-sensitive rodents exposed to prolonged SD lengths is characteristic of diestrus II (Beasley et al. 1981). Had tissues been collected on diestrus I, when progesterone reaches a maximum, differences in plasma progesterone concentrations may have been observed between basal SD and peak LD concentrations. It is also possible that the hypertrophied granulosa cells from both advanced and terminal atretic follicles present in SD ovaries were secreting progesterone at concentrations equal to that produced by corpora lutea in LD ovaries. In vitro studies using antral follicles from golden hamsters (Mesocricetus auratus) suggest that steroidogenesis switches from estradiol to progesterone when follicular atresia is induced (Terranova 1981), and terminal atretic follicles in photoregressed Siberian hamsters are reported to be steroidogenic (van den Hurk et al. 2002).
It is well known that the uterus is a major target of estradiol and that estradiol is essential in maintaining uterine function (Clarke & Sutherland 1990). Indeed, withdrawal of estradiol via ovariectomy (West et al. 1978) or administration of antiestrogen agents (Luo et al. 1997) results in uterine atrophy. Interestingly, the first significant decline in uterine mass in the present study occurred at 3 weeks of SD exposure, when diestrus II estradiol concentrations were still elevated and comparable to those of LD hamsters. It is likely that the significant decline in uterine mass in the presence of normal estradiol concentrations is due to a decline in the number of estradiol receptors or alterations in estrogen receptor coregulatory proteins (Horwitz et al. 1996). Alterations in coregulatory protein expression have been associated with several physiologic events, including cancer (Anzick et al. 1997, Carroll et al. 2000) and initiation of parturition (Condon et al. 2003). Alternatively, it is possible that uterine atrophy in the presence of normal diestrus II estradiol concentrations may be the consequence of declines in estradiol concentrations on other days of the estrous cycle.
Ovaries from hamsters maintained under short photoperiods are characterized by the presence of increased numbers of advanced and terminal atretic follicles, structures that are typical of photoregressed hamsters (luteinized atretic follicles (van den Hurk et al. 2002)). While the exact origin and nature of advanced and terminal atretic follicles are unknown, they probably arise from former atretic follicles (Knigge & Leathem 1956). Advanced atretic follicles typically contain fewer than five TUNEL-positive cells and few cells exhibiting caspase-3 immuno-labeling. These observations suggest that advanced atretic follicles are follicles near the completion of atresia. In the natural estrus cycle of mice, high caspase-3 staining is reported in the late stages of follicular atresia (Fenwick & Hurst 2002); however, to our knowledge, no structures similar to the advanced/terminal atretic follicles found in regressed hamster ovaries have been noted in mice. In the present study, the number of advanced atretic follicles declined in hamsters exposed to SD, while there were concomitant increases in the number of terminal atretic follicles. In general, terminal atretic follicles exhibited no TUNEL labeling and only diffuse cytoplasmic active caspase-3 immunostaining, a fact which may imply that these structures are no longer undergoing apoptosis. The follicle counts, TUNEL and caspase-3 labeling patterns, and caspase-3 mRNA expression strongly suggest that SD exposure induces degrading or atretic follicles that give rise to advanced atretic follicles, which in turn give rise to terminal atretic follicles. Ovaries from hamsters exposed to LD contained advanced atretic follicles, albeit at significantly lower numbers than their SD counterparts, implying that advanced atretic follicles are part of normal follicular atresia. However, no terminal atretic follicles were observed in LD ovaries, suggesting that under the influence of short photoperiods, the normal follicular atresia pathway is altered.
Taken together, data from the present study suggest that 3-week SD exposure induces increases in apoptotic activity, which in turn effectively initiates a decline in ovarian function, as evident by declines in estradiol secretion, number of follicles and ovulation events in subsequent weeks. Indeed, future studies examining ovarian apoptotic activity during weeks 03 of SD exposure are warranted to define the precise moment when ovarian demise begins. In addition, studies are necessary to determine the cellular and hormonal properties of terminal atretic follicles in order to elucidate the possible role of these structures in ovaries of hamsters exposed to short photoperiods. Furthermore, studies are needed to determine how the ovary regains function during spontaneous recrudescence.
| Acknowledgements |
|---|
|
|
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM & Meltzer PS 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277 965968.
Beasley LJ, Johnston PG & Zucker I 1981 Photoperiodic regulation of reproduction in postpartum Peromyscus leucopus. Biology of Reproduction 24 962966.
Bergmann M 1987 Photoperiod and testicular function in Phodopus sungorus. Advances in Anatomy, Embryology, and Cell Biology 105 176.[Medline]
Braw RH & Tsafiri A 1980 Follicles explanted from pentobarbitone-treated rats provide a model for atresia. Journal of Reproduction and Fertility 59 259265.[Abstract]
Bronson FH 1989 In Mammalian Reproductive Biology, Chicago: University of Chicago Press.
Buchanan KL & Yellon SM 1991 Delayed puberty in the male Djungarian hamster: effect of short photoperiod or melatonin treatment on the GnRH neuronal system. Neuroendocrinology 54 96102.[ISI][Medline]
Carroll RS, Brown M, Zhang J, DiRenzo J, De Mora JF & Black PM 2000 Expression of a subset of steroid receptor cofactors is associated with progesterone receptor expression in meningiomas. Clinical Cancer Research 6 35703575.
Chun SY, Billig H, Tilly JL, Furuta I, Tsafriri A & Hsueh AJ 1994 Gonadotropin suppression of apoptosis in cultured preovulatory follicles: mediatory role of endogenous insulin-like growth factor 1. Endocrinology 135 18451853.[Abstract]
Clarke CL & Sutherland RL 1990 Progestin regulation of cellular proliferation. Endocrine Reviews 11 266301.[ISI][Medline]
Condon JC, Jeyasuria P, Faust JM, Wilson JW & Mendelson CR 2003 A decline in the levels of progesterone receptor coactivators in the pregnant uterus at term may antagonize progesterone receptor function and contribute to the initiation of parturition. PNAS 100 95189523.
Coucouvanis EC, Sherwood SW, Carswell-Crumpton C, Spack EG & Jones PP 1993 Evidence that the mechanism of prenatal germ cell death in the mouse is apoptosis. Experimental Cell Research 209 238247.[CrossRef][ISI][Medline]
Dodge JC & Badura LL 2002a 5HT and 5HIAA dialysate levels within the arcuate nucleus of the hypothalamus: relationship with photo-period-driven differences in serum prolactin and luteinizing hormone in the Siberian hamster. Brain Research 946 171178.[CrossRef][ISI][Medline]
Dodge JC, Kristal MB & Badura LL 2002b Male-induced estrus synchronization in the female Siberian hamster (Phodopus sungorus sungorus). Physiological Behaviour 77 227231.
Fenwick MA & Hurst PR 2002 Immunohistochemical localization of active caspase-3 in the mouse ovary: growth and atresia of small follicles. Reproduction 124 659665.[Abstract]
Furuta I, Porkka-Heiskanen T, Scarbrough K, Tapanainen J, Turek FW & Hsueh AJ 1994 Photoperiod regulates testis cell apoptosis in Djungarian hamsters. Biology of Reproduction 51 13151321.[Abstract]
Glass JD 1986 Short photoperiod-induced gonadal regression: effects on the gonadotropin-releasing hormone (GnRH) neuronal system of the white-footed mouse, Peromyscus leucopus. Biology of Reproduction 35 733743.[Abstract]
Guo K, Wolf V, Dharmarajan AM, Feng Z, Bielke W, Saurer S & Friis R 1998 Apoptosis-associated gene expression in the corpus luteum of the rat. Biology of Reproduction 58 739746.
Hoffmann K 1979 Photoperiod, pineal, melatonin and reproduction in hamsters. Progress in Brain Research 52 397415.[Medline]
Hoffmann K & Illnerova H 1986 Photoperiodic effects in the Djungarian hamster. Rate of testicular regression and extension of pineal melatonin pattern depend on the way of change from long to short photoperiods. Neuroendocrinology 43 317321.[ISI][Medline]
Horwitz KB, Jackson TA, Bain DL, Richer JK, Takimoto GS & Tung L 1996 Nuclear receptor coactivators and corepressors. Molecular Endocrinology 10 11671177.[Abstract]
Hsueh AJ, Eisenhauer K, Chun SY, Hsu SY & Billig H 1996 Gonadal cell apoptosis. Recent Progress in Hormone Research 51 433455; discussion 455456.[ISI][Medline]
Hughes FM Jr & Gorospe WC 1991 Biochemical identification of apoptosis (programmed cell death) in granulosa cells: evidence for a potential mechanism underlying follicular atresia. Endocrinology 129 24152422.[Abstract]
Johnson AL 2003 Intracellular mechanisms regulating cell survival in ovarian follicles. Animal Reproduction Science 78 185201.[CrossRef][ISI][Medline]
Knigge KM & Leathem JH 1956 Growth and atresia of follicles in the ovary of the hamster. Anatomy Records 124 679707.[CrossRef]
Knopper LD & Boily P 2000 The energy budget of captive Siberian hamsters, Phodopus sungorus, exposed to photoperiod changes: mass loss is caused by a voluntary decrease in food intake. Physiological and Biochemical Zoology 73 517522.[CrossRef][ISI][Medline]
Luo S, Martel C, Sourla A, Gauthier S, Mâerand Y, Belanger A, Labrie C & Labrie F 1997 Comparative effects of 28-day treatment with the new anti-estrogen EM-800 and tamoxifen on estrogen-sensitive parameters in intact mice. International Journal of Cancer 73 381391.
Matikainen T, Perez GI, Zheng TS, Kluzak TR, Rueda BR, Flavell RA & Tilly JL 2001 Caspase-3 gene knockout defines cell lineage specificity for programmed cell death signaling in the ovary. Endocrinology 142 24682480.
Morita Y & Tilly JL 1999 Oocyte apoptosis: like sand through an hourglass. Developmental Biology 213 117.[CrossRef][ISI][Medline]
Ohno S & Smith JB 1964 Role of fetal follicular cells in meiosis of mammalian oocytes. Cytogenetics 13 324333.[Medline]
Palumbo A & Yeh J 1994 In situ localization of apoptosis in the rat ovary during follicular atresia. Biology of Reproduction 51 888895.[Abstract]
Prendergast BJ & Nelson RJ 2001 Spontaneous regression of enhanced immune function in a photoperiodic rodent Peromyscus maniculatus. Proceedings in Biological Science 268 22212228.[CrossRef]
Pyter LM, Hotchkiss AK & Nelson RJ 2005 Photoperiod-induced differential expression of angiogenesis genes in testes of adult Peromyscus leucopus. Reproduction 129 201209.
Reburn CJ & Wynne-Edwards KE 1996 Novel patterns of progesterone and prolactin in plasma during the estrous cycle in the Djungarian hamster (Phodopus campbelli) as determined by repeated sampling of individual females. Biology of Reproduction 54 819825.[Abstract]
Roughton SA, Lareu RR, Bittles AH & Dharmarajan AM 1999 Fas and Fas ligand messenger ribonucleic acid and protein expression in the rat corpus luteum during apoptosis-mediated luteolysis. Biology of Reproduction 60 797804.
Schlatt S, Niklowitz P, Hoffmann K & Nieschlag E 1993 Influence of short photoperiods on reproductive organs and estrous cycles of normal and pinealectomized female Djungarian hamsters, Phodopus sungorus. Biology of Reproduction 49 243250.[Abstract]
Schmidt KE & Kelley KM 2001 Down-regulation in the insulin-like growth factor (IGF) axis during hibernation in the golden-mantled ground squirrel, Spermophilus lateralis: IGF-I and the IGF-binding proteins (IGFBPs). Journal of Experimental Zoology 289 6673.
Snell G 1941 Biology of the Laboratory Mouse. New York: Dover Publications 5588.
Terranova PF 1981 Steroidogenesis in experimentally induced atretic follicles of the hamster: a shift from estradiol to progesterone synthesis. Endocrinology 108 18851890.[Abstract]
Tilly JL, Kowalski KI, Johnson AL & Hsueh AJ 1991 Involvement of apoptosis in ovarian follicular atresia and postovulatory regression. Endocrinology 129 27992801.[Abstract]
Uilenbroek JT, Woutersen PJ & van der Schoot P 1980 Atresia of preovulatory follicles: gonadotropin binding and steroidogenic activity. Biology of Reproduction 23 219229.[Abstract]
van den Hurk R, Dijkstra G & De Jong FH 2002 Enhanced serum oestrogen levels and highly steroidogenic, luteinized atretic follicles in the ovaries of the Djungarian hamster (Phodopus sungorus) kept under a short photoperiod from birth. European Journal of Endocrinology 147 701710.[Abstract]
Vaughan MK, Buzzell GR, Hoffman RA, Menendez-Pelaez A & Reiter RJ 1994 Insulin-like growth factor-1 in Syrian hamsters: interactions of photoperiod, gonadal steroids, pinealectomy, and continuous melatonin treatment. Proceedings of the Society of Experimental Biology and Medicine 205 327331.
Vaux DL & Strasser A 1996 The molecular biology of apoptosis. PNAS 93 22392244.
West NB, Norman RL, Sandow BA & Brenner RM 1978 Hormonal control of nuclear estradiol receptor content and the luminal epithelium in the uterus of the golden hamster. Endocrinology 103 17321741.[Abstract]
Wynne-Edwards KE, Terranova PF & Lisk RD 1987 Cyclic Djungarian hamsters, Phodopus campbelli, lack the progesterone surge normally associated with ovulation and behavioral receptivity. Endocrinology 120 13081316.[Abstract]
Yellon SM & Goldman BD 1987 Influence of short days on diurnal patterns of serum gonadotrophins and prolactin concentrations in the male Djungarian hamster, Phodopus sungorus. Journal of Reproduction and Fertility 80 167174.[Abstract]
Young KA & Nelson RJ 2000 Short photoperiods reduce vascular endothelial growth factor in the testes of Peromysius leucopus. American Journal of PhysiologyRegulatory, Integrative and Comparative Physiology 279 11321137.
Young KA & Nelson RJ 2001 Mediation of seasonal testicular regression by apoptosis. Reproduction 122 677685.[Abstract]
Young KA, Zirkin BR & Nelson RJ 1999 Short photoperiods evoke testicular apoptosis in white-footed mice (Peromyscus leucopus). Endocrinology 140 31333139.
Young KA, Zirkin BR & Nelson RJ 2001 Testicular apoptosis is down-regulated during spontaneous recrudescence in white-footed mice (Peromyscus leucopus). Journal of Biological Rhythms 16 479488.[Abstract]
Zeleznick AJ, Ihrig LL & Bassett SG 1989 Developmental expression of Ca++/Mg++-dependent endonuclease activity in rat granulosa and luteal cells. Endocrinology 125 22182220.[Abstract]
This article has been cited by other articles:
![]() |
E. W Kabithe and N. J Place Photoperiod-dependent modulation of anti-Mullerian hormone in female Siberian hamsters, Phodopus sungorus Reproduction, March 1, 2008; 135(3): 335 - 342. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |