| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
RESEARCH |
1 Department of Biochemistry and 2 Department of Anatomy, Biosciences Institute, University College Cork, College Road, Cork, Ireland and 3 Tumour Immunology Group, LIFE Centre, University Clinic Grosshadern, Ludwig-Maximilians-University Muenchen, Marchioninistrasse 23, D-81377 Muenchen, Germany
Correspondence should be addressed to T Moore; Email: t.moore{at}ucc.ie
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The biochemical properties and physiological functions of the members of the PSG family remain to be fully elucidated. Currently, multiple lines of evidence suggest an immunomodulatory function to prevent rejection of the allotypic fetus (Majumdar et al. 1982, Harris et al. 1984). Specifically, low PSG levels in the human maternal circulation are associated with threatened abortions, intrauterine growth retardation and fetal hypoxia, and the application of anti-PSG antibodies or vaccination with PSG induces abortion in mice and monkeys, and reduces the fertility of non-pregnant monkeys (Bohn & Weinmann 1976, Hau et al. 1985). In addition, PSG-mediated suppression of T cells is correlated with increased maternal morbidity in purulent septic complications of abortion (Repina et al. 1989), and elevated circulating PSG levels are correlated with improved symptoms of rheumatoid arthritis (Fialova et al. 1991). Human and mouse PSGs induce secretion of anti-inflammatory cytokines from monocytes and macrophages in vitro (Wessells et al. 2000, Snyder et al. 2001), consistent with the observation of PSG-mediated switching of the immune system from a predominantly TH1 response to a predominantly TH2 response, which is considered more compatible with successful pregnancy (Motran et al. 2003).
The only PSG receptor identified to date is the integrin-associated cluster of differentiation 9 antigen (CD9) receptor. In macrophages it was found to bind the N1 domain of both Psg17 and Psg19 (Waterhouse et al. 2002). The interaction of Psg17 and CD9 was found to be necessary for the induction of secretion of anti-inflammatory cytokines (Ha et al. 2005). Psg17 has also been shown to prevent spermegg fusion by interrupting the binding of CD9 to a ligand on the egg surface (Ellerman et al. 2003). No receptor for human PSG has been identified and, unlike mouse Psg17, human PSG do not require CD9 to induce cytokine production from mouse macrophages (Ha et al. 2005).
CD9 is a tetraspanin, which is an integral membrane protein with four transmembrane domains and two extra-cellular domains. Tetraspanin family members have been implicated in a variety of cellular and physiological processes, such as cell motility, aggregation, signalling, and fusion (Boucheix & Rubenstein 2001). Tetraspanins are believed to act as molecular facilitators, grouping together cell-surface proteins and thus increasing the formation and stability of functional protein complexes (Maecker et al. 1997). CD9 associates with a great variety of membrane proteins, such as membrane anchored growth factors, integrins, members of the immunoglobulin superfamily and other tetraspanins (Boucheix & Rubenstein 2001). Although little is known about the role of CD9 in reproduction, human CD9 may function in extravillous trophoblast invasion of maternal tissues (Hirano et al. 1999). CD9 expression has not been analysed in mouse pregnancy, and it is not known whether PSG and CD9 expression patterns overlap in vivo.
In this study we examined the expression of Psg and CD9 during mouse placental development, and we investigated whether CD9 is necessary for successful pregnancy. Our results provide evidence of tissue-specific regulation of mouse Psg genes, and a possible association of secreted Psg protein with vascular endothelium.
| Materials and Methods |
|---|
|
|
|---|
Production of recombinant baculovirus mouse Psg21-V5/His and human PSG1-V5/His
Recombinant Psg21 and PSG1 proteins were produced using the baculovirus protein expression system (Invitrogen Life Technologies).
Subcloning in pBlueBac4.5V5/His
Psg21wt was cloned previously into pcDNA3.1 (Ball et al. 2004). The Psg21wt open reading frame (ORF) was reamplified by PCR, using primers incorporating restriction enzyme sites at each end (XhoI at 5' and EcoRI at 3') to allow ligation into pBlueBac4.5V5/His (Invitrogen Life Technologies) in frame with the V5/His tag. A vector with a carboxyl (C) terminal V5/His tag was used to prevent interference of the tag with putative Psg functional domains at the N terminus. The human PSG1a ORF was amplified by PCR from an existing cDNA clone (Zimmermann et al. 1989).
Production of viral DNA
Recombinant plasmid and Bac-N-Blue DNA (Invitrogen Life Technologies) were co-transfected into adherent Spodoptera frugiperda-9 (Sf9) cells in Graces Insect media (Invitrogen Life Technologies). Cultures were closely observed for signs of viral infection and serial dilutions of the infected culture media were then used for plaque assay. Blue plaques representing sites of recombinant viral infection were picked and used to infect Sf9 s in adherent culture. The cultures were observed for signs of recombinant only viral infection (seen as absence of occlusion bodies (OCC)). The cell suspensions from OCC wells were split into two fractions, one for PCR analysis to confirm absence of wild-type baculovirus and the other to be kept as the initial (P1) viral stock. The P1 viral stock of a recombinant-only culture was then used to generate a small-scale high titre (P2) viral stock, which was then used to generate a large-scale, high titre stock (P3). Plaque assay was then carried out to determine the titre of the P3 viral stock.
Protein production and purification
Small-scale protein expression was performed to establish the optimal multiplicity of infection (MOI) and time course for expression of the recombinant Psg21 and PSG1 protein in Sf9 in suspension in serum-free medium (SF900 II, Invitrogen Life Technologies). Recombinant protein production was determined by Western blot with antibody targeted against the V5 epitope tag. Large-scale expression was carried out in one-litre spinner flasks using the MOI and time course determined previously, in this case, an MOI of 3 phage particles per Sf9 cell and time course of 5 days in SF900 II. After 5 days culture the cells were spun out and the Xpress Protein Purification system (Invitrogen Life Technologies) was used to purify the recombinant protein from the medium. The medium was batch bound to the ProBond nickel chelating resin (Invitrogen Life Technologies), the resin was allowed to settle and the supernatant drained off. The resin was then washed, and bound protein was eluted using increasing concentrations of imidazole. The eluate was collected in 1 ml fractions and analysed for recombinant protein by spectrophotometer and Western blot. Fractions with contaminating proteins were pooled and subjected to a second round of purification on the ProBond resin. All clean fractions of recombinant protein were pooled and dialysed against 50 mM Tris pH 7.5, and then further purified by anion exchange chromatography using an increasing step gradient of NaCl in 50 mM Tris pH 7.5. The clean fractions were then pooled, dialysed against phosphate buffered saline pH 7.5 (PBS) and concentrated using centrifuge concentrators (Millipore, Ireland BV, Cork, Ireland). Concentrated protein was used for polyclonal antibody production.
Production of polyclonal antisera to Psg21 and PSG1
Antiserum production
Preimmune bleeds were taken prior to inoculation of rabbits with recombinant Psg21 and PSG1 proteins. An initial injection of 500 µg recombinant protein was administered with Freunds Complete Adjuvant, followed by four booster doses of 250 µg protein with Freunds Incomplete Adjuvant at 3-week intervals. Test bleeds were taken 10 days after each injection and tested on Western blot against recombinant baculovirus Psg21 and PSG1. A final bleed from each rabbit was taken by exsanguination.
Antiserum validation
Polyclonal antisera were tested against recombinant baculovirus Psg21 and PSG1, placental tissue homogenates from pregnant and non-pregnant mice, or tissue homogenates from human term placentas or maternal pregnant serum, by Western blotting.
Immunohistochemistry and immunofluoresence
Tissue preparation
Tissues were collected from non-pregnant and pregnant mice at varying stages of pregnancy, washed in cold (4 °C) PBS, embedded in OCT cryopreservation compound (BDH Laboratory Supplies, Poole, UK) and frozen in an iso-pentane bath in liquid nitrogen or at 80 °C. Frozen tissue blocks were stored at 80 °C until use. Sections (5 µm thick) were cut and mounted on Superfrost Plus microscope slides (BDH Laboratory Supplies), air dried for 1530 min, fixed in cold (4 °C), fresh 4% paraformaldehyde in PBS for 10 min and then rinsed in cold PBS. The slides were then equilibrated in Tris-buffered saline at room temperature (TBS, pH 7.4) for 5 min. Sections for immunohistochemistry were treated for endogenous peroxidase activity by incubating in 2% hydrogen peroxide in TBS for 30 min.
Immunohistochemistry
Immunohistochemistry (IHC) was performed using the Vectastain Elite ABC system (Vector Laboratories Ltd, Peterborough, UK). For immunohistochemical localisation of Psg, sections were blocked with 5% non-fat milk in TBS containing 0.1% Triton-X 100 (TBS-Tx) for 1 h at room temperature (RT) and then incubated with primary antiserum or preimmune serum (Psg21 1:500, preimmune serum 1:500) in blocking buffer overnight at 4 °C. Sections were then washed three times for 10 min in TBS-Tx before incubating with biotinylated anti-rabbit secondary antibody (Vector Laboratories, 1:200), washed again three times for 10 min in TBS-Tx and detected using the ABC system and Vector VIP peroxidase substrate kit (Vector Laboratories), following the manufacturers instructions. Optimisation of different blocking buffers showed that non-fat milk gave the best results; negative controls were therefore needed in all experiments to ensure endogenous biotin in the milk did not interfere with the ABC system. To avoid possible variation in biotin levels from the non-fat milk, TBS-Tx non-fat milk was prepared in bulk, aliquoted and frozen at 20 °C and used for all procedures. Following IHC, sections were counterstained with Harris haematoxylin (BDH), differentiated, dehydrated, and mounted with DePeX (BDH) permanent mounting medium.
Immunohistochemical staining with a rat anti-mouse CD9 antibody (RDI-MCD9-C8, Research Diagnostics Inc., Concord, MA, USA) was carried out using the Vector Mouse on Mouse (MOM) kit (Vector Laboratories) following the manufacturers instructions, to minimise cross reactivity between the rat secondary antibody and mouse tissues. Briefly, sections were blocked overnight with MOM IgG blocking solution in TBS-Tx at 4 °C, washed twice for 5 min with TBS-Tx, incubated with MOM solution in TBS-Tx for 15 min, incubated with anti-CD9 antibody at a dilution of 1:1000 for 1 h at RT, washed three times for 10 min in TBS-Tx, incubated with secondary biotinylated anti-rat (Vector Laboratories) at 1:1000 for 1 h then washed, detected and mounted as for Psg. An anti-Ceacam antibody, AgB10 (Kuprina et al. 1990), was used at a dilution of 1:50 in conjunction with the MOM kit as for CD9.
Immunofluorescence
Single antibody immunofluorescence was carried out using the same basic procedure as for immunohistochemistry except fluorescent secondary antibodies were used instead of the ABC system. Donkey anti-rabbit rhodamine (Abcam Plc, Cambridge, UK) for Psg was used at a concentration of 1:100 and sheep anti-rat FITC (Abcam) for CD9 at a concentration of 1:100. After incubation with secondary antibody, sections were washed three times for 10 min with TBS-Tx, once for 5 min in PBS, post fixed with cold 4% paraformaldehyde in PBS for 10 min, washed twice for 5 min in PBS and then mounted with Vectashield Mounting medium with DAPI (Vector Laboratories).
Double immunofluorescence was carried out sequentially due to the incompatibility of the rabbit (for Psg) antibodies with the MOM kit required for the rat antibodies (for CD9 and CD31). Psg staining was carried out first, followed by CD9 or CD31. The anti-CD31 antibody (Abcam) was used at 1:20, with blocking and washing steps as for the anti-CD9 antibody.
In situ hybridisation
In situ hybridisation was carried out using digoxigenin-labelled RNA probes. A 252 bp fragment was amplified from the Psg21 A domain incorporating EcoRI restriction sites at the 5' and 3' ends (forward (F) 5' GCGGAATTCTGTTCAAGTCAACATCTACAAGC; reverse (R) 5' CGCGAATTCGGGTTGAAGGCCTCACATT). The resulting PCR fragment was ligated into the pSPT18 multiple cloning site at the EcoRI site. Two constructs were created with the insert in opposite orientations for generating sense and antisense probes. RNA probes were synthesised in the presence of digoxigenin-labelled UTP using T7 polymerase. In situ hybridisations were carried out on 5 µm thick cryosections mounted on Superfrost Plus microscope slides (BDH). All solutions were prepared using diethylpyrocarbonate-treated water or RNase-free molecular biology grade water (Sigma); all glassware, bench tops and equipment were treated with RNase Away (Invitrogen Life Sciences) to remove RNase contamination prior to each experiment. Sections were treated as follows: air dried for 30 min, fixed in cold (4%) paraformaldehyde in PBS for 10 min, rinsed three times for 5 min in TBS, 200 mM HCl for 10 min, 0.5% acetic anhydride in 100 mM Tris for 10 min, rinsed in TBS for 5 min, baked on a hotplate at 95 °C for 4 min, rinsed in TBS and then incubated at 55 °C with hybridisation buffer for 1 h. Sections were then incubated with 0.1 ng/µl probe in hybridisation buffer at 55 °C in a humid chamber for 2 h. Unbound probe was removed by washing twice for 5 min in 4 x SSC at RT, three times for 5 min in 60% deionised formamide/0.2 x SSC at 55 °C, twice for 5 min in 2 x SSC at 37 °C, two times for 10 min in 0.1 x SSC at 37 °C. Sections were then equilibrated in TBS and blocked overnight at 4 °C with TBS-Tx containing 2% normal sheep serum (NSS). For immunological detection of bound digoxigenin (DIG) probe, anti-DIG antibody (Roche) was used at a dilution of 1:700 in TBS-Tx NSS for two hours at room temperature. Sections were washed twice for 10 min in TBS and then either detected using Vector Red alkaline phosphatase substrate kit (Vector Laboratories) following the manufacturers instructions and counterstained with haematoxylin, or detected using NBT-BCIP and the DIG Nucleic Acid detection kit (Roche) following the manufacturers instructions.
CD9 expression analysis of maternal tissues
Decidual tissue was dissected from implantation sites of pregnant CD1 mice at E8, E9, E10 and E11 along with the corresponding uterine tissues. Lung, liver and brain from an E10 pregnant mouse were also included. Tissues were homogenised in lysis buffer (0.1 M TrisHCl pH8, 0.1% Triton-X 100) containing protease inhibitors (phenylmethyl-sulphonyl fluoride 100 µg/ml, leupeptin 0.5 µg/ml, aprotinin 0.5 µg/ml, pepstatin A 1 µg/ml), insoluble debris was removed and the supernatants quantified and used for SDS-PAGE and Western blotting analysis. SDS-PAGE (for Western blotting) for CD9 was carried out under non-reducing conditions, with 15 µg protein of each sample being heat denatured at 95 °C for 10 min in a non-reducing loading buffer and resolved on a 5% stacking/15% resolving gel. A duplicate gel was set up, as for CD9, for the ß-actin loading control but run under reducing conditions. The gels were then electrotransferred to nitrocellulose membrane and immunodetection was carried out. Briefly, the blots were blocked with 5% non-fat milk in phosphate buffered saline 0.1% Tween 20 (PBS-T) for 1 h at RT, incubated with primary antibody overnight at 4 °C, washed three times for 10 min in PBS-T, incubated for 1 h with secondary horse-radish peroxidase (HRP)-conjugated antibody in PBS-T, washed three times in PBS-T for 10 min and then detected using Supersignal West Pico Chemiluminescent Substrate (Pierce Biotechnology Inc, Rockford, IL, USA) and exposed to Kodak X-OMAT AR film (Sigma). Unless stated otherwise incubations and washes were carried out at room temperature and on a rocker. The primary antibodies, CD9 (used previously) and ß-actin (Sigma), were used at a dilution of 1:1000 in blocking buffer. The secondary antibodies, anti-rat-HRP (Sigma) for CD9 and anti-mouse-HRP (Sigma) for ß-actin, were used at a dilution of 1:20 000 in PBS-T.
Psg gene expression analysis in trophoblast giant cells
Placentas from CD1 mice were collected at E8, E9, E10, E11, and primary trophoblast giant cells were dissected from the surrounding tissue. For each developmental stage, cDNA was analysed from two litters (cDNA was pooled from approximately six placentas per litter). Extracted tissue was homogenised in 1 ml TRI-reagent (Sigma-Aldrich) and total RNA was isolated. First-strand cDNA was synthesised using 1 µg total RNA as template in a 20 µl reaction using random hexamer priming and Moloney-murine leukaemia virus reverse transcriptase (Invitrogen).
Quantitative RT-PCR
Primers were designed that amplify all known mouse Psg gene sequences: PsgF: 5'-TYCAYCCDKTGGHTCTTCAAYA; PsgR: 5'-CACAYYGRTAMTYTCCASCATC. Normalisation of expression level to the housekeeping gene, hypoxanthine-guanine phosphoribosyl transferase (Hprt), was used to avoid discrepancies caused by variations in input RNA or in reverse transcription efficiencies. The following primer sequences were used: Hprt forward (HprtF): 5'-CTCATGGACTGATTATGGACAGGAC; Hprt reverse (HprtR): 5'-GCAGGTCAGCAAAGAACTTATAGCC. Quantitative PCR was performed using the ABI PRISM 7900 sequence detection system (SDS) and the SYBR GREEN qPCR kit (Applied Bio-systems, Foster City, CA, USA). The SYBR GREEN PCR master mix consists of Amplitaq Gold DNA polymerase, optimised PCR buffer, 25 mM MgCl2, dNTP mix and AmpErase UNG. PCR amplifications were performed in a total volume of 15 µl in duplicate wells.
The following PCR protocol was used: denaturation program (95 °C for 10 min), amplification and quantification program repeated for 40 cycles (95 °C for 15 s, 55 °C for 30 s, 72 °C for 45 s with a single fluorescence measurement), melting curve program (60 °C 95 °C with a heating rate of 1°C per 30 s and a continuous fluorescence measurement). Thereafter, PCR products were identified by generating a melting curve, which was also used to assess the occurrence of putative PCR artefacts (primer-dimers) or non-specific PCR products. The sizes of the RT-PCR products were confirmed by gel electrophoresis on a standard 1.5% agarose gel stained with ethidium bromide and visualised by exposure to ultraviolet light. Results were described as mean Psg expression relative to mean Hprt expression.
Identification of Psg gene transcripts in trophoblast giant cells
To identify Psg genes expressed in giant cells, PsgF and PsgR primers previously described were used to amplify Psg cDNA transcripts present (Psg22 and Psg25 are of identical sequence in the amplicon generated by these primers). PCR was performed in 50 µl using 0.4 U Accuzyme (Bioline, London, UK) according to the manufacturers instructions. RT-PCR products were purified using the Qiaquick PCR purification kit (Qiagen, Crawley, West Sussex, UK). Purified amplicons were subcloned into pSTblue-1 vector and transformed into NovaBlue Singles competent cells (Novagen, EMD Bioscience, Madison, MI, USA). Positive clones were identified by a diagnostic PCR screen of bacterial colonies. For each developmental stage tested eight clones per litter were bi-directionally sequenced (Macrogen Inc, Gasan-Dong, Gaumcheon-gu, Korea). In order to distinguish between Psg22 and Psg25 and to ensure that there was no preferential amplification of any particular Psg, the above experiment was repeated using the primer set Psg-all2, which has the following sequences: Psg-all2F: 5' GTGTTGACAATCTGCCAGAGAA-TCTT; Psg-all2R: 5' CTCCTGGGTGACATTTTGGATC. PCR was performed in 50 µl using 0.4 U Accuzyme according to the manufacturers instructions (Bioline). The following amplification protocol was used: denaturation at 95 °C for 5 min, amplification repeated for 40 cycles at 95 °C for 30 s, 55 °C for 30 s, 72 °C for 45 s and elongation cycle at 72 °C for 10 min. An amplicon of 176 bp was generated which was confirmed by gel electrophoresis on a standard 1.5% agarose gel as described above.
Embryo transfers to CD9 / and CD9 + / +mice
Matings between CD9 heterozygous (+ / ) males and females were used to generate homozygous null ( / ) females as test subjects and wild-type (+ / +) females as littermate controls on the same genetic background. CD9 + / + (B6CBF2) embryos were produced, collected and transferred at the late morula or early blastocyst stage to the uterine horns of CD9 + / + or CD9 / pseudo-pregnant females as described (Nagy et al. 2003), with eight embryos being transferred to each uterine horn. Recipients were monitored daily for recovery, signs of pregnancy and pregnancy loss. Mice were killed at either E10 or E16, the uterus was removed and the number of successful and failed implantation sites was recorded.
| Results |
|---|
|
|
|---|
Using immunohistochemistry, Psg21 antiserum produced a pattern of staining on tissue sections of mouse placenta that was broadly consistent with expectations (see below). However, although it detected recombinant Psg21-V5/His on Western blots, it did not detect Psg in mouse placental lysates or in maternal serum of pregnant mice. It also failed to detect recombinant Psg21 that was over-expressed in HeLa cells from a transfected pcDNA3.1 (Invitrogen Life Technologies) expression vector (data not shown). In contrast, the anti-human PSG1 antiserum worked effectively on Western blots, detecting bands consistent with endogenous PSG in human pregnant sera and placental lysates, and recombinant PSG1 and PSG9 over-expressed in HeLa cells from transfected pcDNA3.1 expression vectors (data not shown). These results were identical to those obtained using AB653, a commercially sourced anti-human PSG antibody raised against PSG purified from the urine of pregnant women. When tested against mouse placental tissues or transgenically over-expressed recombinant mouse Psg21 in HeLa cell lysates, PSG1 antiserum did not detect mouse Psg on Western blots.
To exclude the possibility of cross-reaction of the Psg21 antiserum to the widely expressed Ceacam proteins, which are closely related to Psg, the antiserum was tested by immunohistochemistry on mouse tissues that express Ceacam, but not Psg proteins including liver, colon, small intestine, testis, ovary, brain and non-pregnant uterus. The anti-Ceacam antibody, AgB10 (Kuprina et al. 1990), was used as a positive control (Fig. 1b
). The Psg21 antiserum did not cross-react with Ceacam in bile canaliculi of liver (Fig. 1a
), nor in any of the other tissues tested (data not shown). Pre-immune serum for the Psg21 antiserum was used as a negative control (Fig. 1c
).
|
|
|
|
Double immunoflouresence staining experiments with the anti-CD9 and anti-Psg21 antisera revealed that both proteins are found contemporaneously at several locations in fetal and maternal tissues. Psg and CD9 are found on the cell surface of primary and secondary trophoblast giant cells (Fig. 4A, h, k, l
).
In the decidua, from the earliest observed expression of Psg (E8), there is evidence of co-localisation of Psg and CD9 in the endothelium of capillaries and vascular spaces within the decidua, which is evident until E11 (Fig. 4A, eg, i, j
). CD9 expression in the decidua starts at a much earlier stage (E6) and is both intense and ubiquitous.
Psg expression levels exhibit tissue and developmental stage specificity
Quantitative RT-PCR was used to determine the level of Psg gene transcripts in the trophoblast giant cells and in the spongiotrophoblast. PCR primers were designed to amplify a region in the N domain of all known mouse Psg genes. Primer concentration was optimised to determine the lowest threshold cycle (Ct) while minimising non-specific amplification. This concentration was found to be 300 pmol for the PsgF and PsgR primer set, and dissociation curves for the PCR product demonstrated a single specific peak indicating absence of non-specific amplification.
In trophoblast giant cells there is increased Psg expression between E8 and E11 (Fig. 5
). Psg transcript levels double from E8 to E9 and from E9 to E10. In ectoplacental cone (EPC), there is a fivefold increase in Psg transcript levels between E9 and E11 (Fig. 5
). However, absolute levels in the EPC are low, with E10 giant cells having approximately sixfold higher levels than E10 EPC. In dissected whole placenta samples (of which only the spongiotrophoblast compartment supports Psg gene transcription), Psg transcript levels increased fourfold from E12 to E15 (Fig. 5
), and thereafter declined by approximately fifty per cent to E18.
|
|
CD9 was not required for a successful pregnancy up to E16, the latest stage at which embryo recipients were examined (Table 2
). No difference was observed between CD9 + /+ and CD9 / recipients with respect to number of implantations, number of resorptions, developmental stage or gross morphology of embryos or placentas.
|
| Discussion |
|---|
|
|
|---|
Psg expression and localisation were analysed using a combination of in situ hybridisation to mRNA and immunohistochemistry and immunofluorescence. At the time of this study, a specific anti-mouse Psg antibody was not available, and stocks of commercially available anti-human PSG (AB653) were low. We therefore produced antisera to recombinant mouse Psg21 and human PSG1. Our anti-PSG1 antiserum behaved predictably on Western blots of human tissues, comparable to AB653. However, the anti-Psg21 antiserum did not detect endogenous mouse Psg on Western blot, but was successfully used for immunohistochemistry of trophoblast giant cells. Unexpectedly, however, the Psg21 antibody did not detect Psg in spongiotrophoblast, the major site of Psg gene transcription. Potential explanations for this anomaly are that the Psg21 antiserum recognises a restricted set of epitopes that may only be present in the limited set of Psg genes expressed in giant cells (see below), or there may be masking of relevant epitopes (e.g. by glycosylation) in spongiotrophoblast. Alternatively, in spite of high levels of Psg mRNA, there may be low steady state levels of Psg protein due to translational regulation or rapid turnover. An alternative explanation, given our failure to validate our anti-Psg21 antiserum to the same standard as our anti-PSG1 antiserum, is that staining of giant cells is artefactual. While we cannot formally exclude this possibility subject to the generation of further anti-mouse Psg antibodies, we consider it unlikely because staining is confined to giant cells, which express Psg mRNA, and to maternal vasculature expressing the Psg receptor CD9 (see below), which would be directly exposed to secreted Psg.
Subject to the aforementioned caveat, Psg staining was observed on the endothelial lining of vascular spaces in the decidual tissue surrounding the implantation site from E8 to E11. Since there was no evidence from this or previous studies of Psg gene expression in endothelium of decidual tissues, we conclude that this staining may represent secreted Psg from fetal tissues, which becomes associated with maternal vascular endothelium. There is extensive angiogenesis and vascular remodelling associated with pregnancy, and trophoblast giant cells produce a complex array of angiogenic and anti-angiogenic and vasoactive compounds (Cross et al. 2002). Currently, Psg are thought to regulate the maternal immune system during pregnancy; however, the evidence in support of this hypothesis has largely been generated in vitro using immune cell models (Wessells et al. 2000, Snyder et al. 2001, Motran et al. 2003), and there remains the possibility that different Psg proteins encode different functions. One interpretation of our finding that Psg may associate with maternal vasculature is that some Psg may exhibit vasoactivity or angiogenesis-related functions.
Using immunohistochemistry and immunofluorescence, we found that CD9 is widely expressed in the fetal compartments of the placenta and in maternal decidual and other uterine tissues throughout pregnancy. CD9 is evident both intracellularly and on the cell surface of giant cells from E8 to E11. Rodent trophoblast giant cells are analogous to extravillous cytotrophoblast cells of the human placenta; both are polyploid and invasive, and have similar patterns of trophoblast cell subtype-specific gene expression (Hemberger & Cross 2001). In the human placenta, the intensity of CD9 expression in the extravillous trophoblast cells differs between early pregnancy and term: expression in the extravillous trophoblast (EVT) invading the endometrium in early pregnancy is weak, but in the placental bed and chorionic laevae of the term placenta (where EVTs have ceased invasion into the endometrium) expression is intense (Hirano et al. 1999). This suggests that human CD9 might have a role in inhibiting cell invasion; however, from our data, we cannot confidently propose an analogous function for mouse CD9. From E13 onwards, CD9 staining is found in both the spongiotrophoblast and the labyrinth; in the latter case staining is predominantly associated with the cells lining the vascular channels.
Staining of decidual tissues was particularly intense, with evidence for both cytoplasmic and cell surface staining from E6. The significance of the different distributions of CD9 staining of decidual cells on the mesometrial and antimesometrial aspects of the implanted embryo at later stages is unclear: the intense staining of decidual cells on the antimesometrial aspect is particularly striking, whereas on the mesometrial aspect, staining was mostly confined to the surface of endothelial cells lining vascular spaces. The strong cytoplasmic staining of CD9 in decidual cells is somewhat unusual; however the overall magnitude of CD9 staining in decidual cells is similar to other tissues, as judged by Western blot. CD9 is generally found on the cell surface; however, occasionally, it is located intracellularly e.g. in eosinophils and platelets, where it is stored pending transfer to the cell surface upon activation (Fernvik et al. 1995, Brisson et al. 1997).
In summary, our findings show that there is considerable scope for secreted Psg to interact with maternal CD9. However, our results suggest that the bulk of CD9 expression in pregnancy is not associated with immune cells but, rather, with maternal decidual and vascular tissues. Our related finding of an association of Psg and vascular endothelium supports a scenario whereby Psg secreted from fetal tissues interacts with CD9 on the maternal vasculature. However, whether this putative interaction would result in the activation of signalling pathways relevant to endothelial cell function is unclear. An alternative scenario, based on the concept of maternal-fetal conflict (Moore & Haig 1991, Haig 1993), is that maternal CD9 expressed on vascular endothelium acts as a sink or decoy receptor for Psg, thereby reducing the amount of Psg available for interacting with maternal immune cells. In addition, we add the caveat that, because of the widespread expression of CD9 in maternal tissues, the observed co-localisation with Psg could be coincidental. Confirmation of putative functional interactions between these proteins at overlapping sites in maternal tissues will therefore require further analysis.
The independent expansion of primate and rodent PSG gene families in evolution suggests convergence of function (McLellan et al. 2005b). However, a previous semi-quantitative study of Psg gene expression in mouse pregnancy indicated that different family members exhibit different expression levels between E11 and E18, suggesting the possibility of divergent functions, at least within the mouse Psg family (McLellan et al. 2005a). To investigate this possibility further, we analysed the expression profile of Psg genes in the giant cells and spongiotrophoblast using quantitative methods. The earliest that Psg transcripts have been detected in the murine placenta is E6.5 in trophoblast giant cells (Finkenzeller et al. 2003). It is difficult to isolate cDNA from specific embryonic tissues at this stage, so our analysis began at E8. First, we analysed levels of total Psg gene expression using PCR primers designed to amplify transcripts from all Psg genes. Total levels of Psg transcripts in giant cells increased between E8 and E11, but remained considerably lower (approximately tenfold) than in whole placenta from mid to late gestation. This is consistent with our failure to detect Psg transcripts in giant cells using in situ hybridisation. Very low levels of Psg transcription were also detected in dissected ectoplacental cones; this may represent contamination from adherent giant cells or, alternatively, the earliest manifestation of differentiating spongiotrophoblast from late E10 and E11. Psg22 was overwhelmingly the most abundant Psg transcript in giant cells between E8 and E11, consistent with a previous study that did not detect Psg22 expression from E11 onwards, when the giant cells form a progressively reduced proportion of placental tissues (McLellan et al. 2005a). Psg22 may be expressed virtually exclusively in giant cells and may encode a specific or additional function not associated with other Psg proteins. In this context, it would be interesting to determine whether Psg22, like Psg17 and Psg19, binds CD9.
In spite of the widespread expression of CD9 in the pregnant uterus, the transfer of wild-type embryos to CD9-deficient females resulted in comparable pregnancy rates to embryos transferred to wild-type females, suggesting that maternal CD9 expression is not essential for successful implantation or maintenance of pregnancy. If CD9 represented the sole receptor for secreted fetal Psg, the CD9 null female would represent a surrogate Psg null mutant, with important implications for understanding the significance of Psg in pregnancy. However, it is currently unclear whether all mouse Psg bind CD9, or whether those that do, do so exclusively. In this context, it is noteworthy that human PSG do not bind CD9, but nevertheless induce expression of a similar range of cytokines to mouse Psg from monocytes (Ha et al. 2005). The elucidation of Psg function in mouse pregnancy will therefore require further developmental and biochemical studies using techniques such as gene targeting to assess the importance of specific Psg genes, and proteomics to collate the full spectrum of putative Psg/receptor interactions on trophoblast cells, maternal vascular endothelium and maternal immune cells.
| Acknowledgements |
|---|
|
|
|---|
| Footnotes |
|---|
P Dockery is now at Department of Anatomy, National University of Ireland, Galway, University Road, Galway, Ireland
| References |
|---|
|
|
|---|
Ball M, McLellan A, Collins B, Coadwell J, Stewart F & Moore T 2004 An abundant placental transcript containing an IAP-LTR is allelic to mouse pregnancy-specific glycoprotein 23 (Psg21): cloning and genetic analysis. Gene 325 103113.[CrossRef][ISI][Medline]
Bohn H & Weinmann E 1976 [Antifertility effect of an active immunization of monkeys with human pregnancy-specific beta 1-glyco-protein (SP1) (authors transl)]. Archiv fur Gynakologie 221 305312.[CrossRef][ISI][Medline]
Boucheix C & Rubenstein E 2001 Tetraspanins. Cell Molecular Life Science 58 11891205.
Brisson C, Azorsa DO, Jennings LK, Moog S, Cazenave JP & Lanza F 1997 Co-localization of CD9 and GPIIb-IIIa (alpha IIb beta 3 integrin) on activated platelet pseudopods and alpha-granule membranes. Histochemistry Journal 29 153165.
Brummendorf T & Rathjen FG 1994 Cell adhesion molecules. 1. Immunoglobulin superfamily. Protein Profile 1 9511058.[ISI][Medline]
Cross JC, Hemberger M, Lu Y, Nozaki T, Whiteley K, Masutani M & Adamson SL 2002 Trophoblast functions, angiogenesis and remodeling of the maternal vasculature in the placenta. Molecular and Cellular Endocrinology 187 207212.[CrossRef][ISI][Medline]
DeLisser HM, Christofidou-Solomidou M, Strieter RM, Burdick MD, Robinson CS, Wexler RS, Kerr JS, Garlanda C, Merwin JR, Madri JA & Albelda SM 1997 Involvement of endothelial PECAM-1/CD31 in angiogenesis. American Journal of Pathology 151 671677.[Abstract]
Ellerman DA, Ha C, Primakoff P, Myles DG & Dveksler GS 2003 Direct binding of the ligand PSG17 to CD9 requires a CD9 site essential for spermegg fusion. Molecular Biology of Cell 14 50985103.
Fernvik E, Hallden G, Hed J & Lundahl J 1995 Intracellular and surface distribution of CD9 in human eosinophils. Acta Pathologica, Micro-biologica et Immunologica Scandinavica 103 699706.
Fialova L, Kohoutova B, Peliskova Z, Malbohan I & Mikulikova L 1991 [Serum levels of trophoblast-specific beta-1-globulin (SP1) and alpha-1-fetoprotein (AFP) in pregnant women with rheumatoid arthritis]. Ceskoslovenská Gynekologie 56 166170.[Medline]
Finkenzeller D, Fischer B, Lutz S, Schrewe H, Shimizu T & Zimmer-mann W 2003 Carcinoembryonic antigen-related cell adhesion molecule 10 expressed specifically early in pregnancy in the decidua is dispensable for normal murine development. Molecular and Cellular Biology 23 272279.
Ha CT, Waterhouse R, Wessells J, Wu JA & Dveksler GS 2005 Binding of pregnancy-specific glycoprotein 17 to CD9 on macrophages induces secretion of IL-10, IL-6, PGE2, and TGF-ß1. Journal of Leukocyte Biology 77 948957.
Haig D 1993 Genetic conflicts in human pregnancy. Quarterly Review of Biology 68 495532.[CrossRef][Medline]
Han E, Phan D, Lo P, Poy MN, Behringer R, Najjar SM & Lin SH 2001 Differences in tissue-specific and embryonic expression of mouse Ceacam1 and Ceacam2 genes. Biochemistry Journal 355 417423.[CrossRef][ISI][Medline]
Harris SJ, Anthony FW, Jones DB & Masson GM 1984 Pregnancy-specific-beta 1-glycoprotein: effect on lymphocyte proliferation in vitro. Journal of Reproductive Immunology 6 267270.[CrossRef][ISI][Medline]
Hau J, Gidley-Baird AA, Westergaard JG & Teisner B 1985 The effect on pregnancy of intrauterine administration of antibodies against two pregnancy-associated murine proteins: murine pregnancy-specific beta 1-glycoprotein and murine pregnancy-associated alpha 2-glyco-protein. Biomedica et Biochimica Acta 44 12551259.
Hemberger M & Cross JC 2001 Genes governing placental development. Trends in Endocrinological Metabolism 12 162168.
Hirano T, Higuchi T, Katsuragawa H, Inoue T, Kataoka N, Park KR, Ueda M, Maeda M, Fujiwara H & Fujii S 1999 CD9 is involved in invasion of human trophoblast-like choriocarcinoma cell line, BeWo cells. Molecular Human Reproduction 5 168174.
Kromer B, Finkenzeller D, Wessels J, Dveksler G, Thompson J & Zimmermann W 1996 Coordinate expression of splice variants of the murine pregnancy-specific glycoprotein (PSG) gene family during placental development. European Journal of Biochemistry 242 280287.[ISI][Medline]
Kuprina NI, Baranov VN, Yazova AK, Rudinskaya TD, Escribano M, Cordier J, Gleiberman AS & Goussev AI 1990 The antigen of bile canaliculi of the mouse hepatocyte: identification and ultra-structural localization. Histochemistry 94 179186.[CrossRef][ISI][Medline]
Lei KJ, Sartwell AD, Pan CJ & Chou JY 1992 Cloning and expression of genes encoding human pregnancy-specific glycoproteins. Journal of Biological Chemistry 267 1637116378.
Lin TM, Halbert SP & Spellacy WN 1974 Measurement of pregnancy-associated plasma proteins during human gestation. Journal of Clinical Investigation 54 576582.[ISI][Medline]
McLellan AS, Fischer B, Dveksler G, Hori T, Wynne F, Ball M, Okumura K, Moore T & Zimmermann W 2005a Structure and evolution of the mouse pregnancy-specific glycoprotein (Psg) gene locus. BMC Genomics 6 4.[CrossRef][Medline]
McLellan AS, Zimmermann W & Moore T 2005b Conservation of pregnancy-specific glycoprotein (PSG) N-domains following independent expansions of the gene families in rodents and primates. BMC Evolutionary Biology 5 39.
Maecker HT, Todd SC & Levy S 1997 The tetraspanin superfamily: molecular facilitators. FASEB Journal 11 428442.[Abstract]
Majumdar S, Bapna BC, Mapa MK, Gupta AN, Devi PK & Subrahmanyam D 1982 Pregnancy-specific proteins: suppression of in vitro blastogenic response to mitogen by these proteins. International Journal of Fertility 27 6669.[ISI][Medline]
Moore T & Haig D 1991 Genomic imprinting in mammalian development: a parental tug-of-war. Trends in Genetics 7 4549.[ISI][Medline]
Motran CC, Diaz FL, Montes CL, Bocco JL & Gruppi A 2003 In vivo expression of recombinant pregnancy-specific glycoprotein 1a induces alternative activation of monocytes and enhances Th2-type immune response. European Journal of Immunology 33 30073016.[CrossRef][ISI][Medline]
Nagy A, Gertsenstein M, Vintersten K & Behringer R 2003 In Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor, New York: CSHL Press.
Newman PJ 1997 The biology of PECAM-1. Journal of Clinical Investigation 100 S25S29.[ISI][Medline]
Rebstock S, Lucas K, Weiss M, Thompson J & Zimmermann W 1993 Spatiotemporal expression of pregnancy-specific glycoprotein gene rnCGM1 in rat placenta. Developmental Dynamics 198 171181.[ISI][Medline]
Repina MA, Blagoslovenskii GS, Gnilevskaia ZU & Ivanova LV 1989 [The effect of specific trophoblastic beta 1-glycoprotein on changes in the cellular link of immunity in infected abortion]. Akush-erstvo i Ginekologiia 12 4750.
Snyder SK, Wessner DH, Wessells JL, Waterhouse RM, Wahl LM, Zimmermann W & Dveksler GS 2001 Pregnancy-specific glycoproteins function as immunomodulators by inducing secretion of IL-10, IL-6 and TGF-beta1 by human monocytes. American Journal of Reproduction and Immunology 45 205216.[CrossRef]
Sorensen S 1984 Pregnancy-"specific" beta 1-glycoprotein (SP1): purification, characterization, quantification and clinical application in malignancies (a review). Tumour Biology 5 275302.
Teglund S, Olsen A, Khan WN, Frangsmyr L & Hammarstrom S 1994 The pregnancy-specific glycoprotein (PSG) gene cluster on human chromosome 19: fine structure of the 11 PSG genes and identification of 6 new genes forming a third subgroup within the carcinoembryonic antigen (CEA) family. Genomics 23 669684.[CrossRef][ISI][Medline]
Thompson J, Koumari R, Wagner K, Barnert S, Schleussner C, Schrewe H, Zimmermann W, Muller G, Schempp W & Zaninetta D 1990 The human pregnancy-specific glycoprotein genes are tightly linked on the long arm of chromosome 19 and are coordinately expressed. Biochemical and Biophysical Reseach Communications 167 848859.
Waterhouse R, Ha C & Dveksler GS 2002 Murine CD9 is the receptor for pregnancy-specific glycoprotein 17. Journal of Experimental Medicine 195 277282.
Wessells J, Wessner D, Parsells R, White K, Finkenzeller D, Zimmermann W & Dveksler G 2000 Pregnancy specific glycoprotein 18 induces IL-10 expression in murine macrophages. European Journal of Immunology 30 18301840.[CrossRef][ISI][Medline]
Zebhauser R, Kammerer R, Eisenried A, McLellan A, Moore T & Zimmermann W 2005 Identification of a novel group of evolutionary conserved members within the rapidly diverging murine Cea family. Genomics 86 566580.[CrossRef][ISI][Medline]
Zhou GQ & Hammarstrom S 2001 Pregnancy-specific glycoprotein (PSG) in baboon (Papio hamadryas): family size, domain structure, and prediction of a functional region in primate PSGs. Biology of Reproduction 64 9099.
Zhou GQ, Baranov V, Zimmermann W, Grunert F, Erhard B, Mincheva-Nilsson L, Hammarstrom S & Thompson J 1997 Highly specific monoclonal antibody demonstrates that pregnancy-specific glycoprotein (PSG) is limited to syncytiotrophoblast in human early and term placenta. Placenta 18 491501.[CrossRef][ISI][Medline]
Zimmermann W, Weiss M & Thompson JA 1989 cDNA cloning demonstrates the expression of pregnancy-specific glycoprotein genes, a subgroup of the carcinoembryonic antigen gene family, in fetal liver. Biochemical and Biophysical Research Communications 163 11971209.[CrossRef][ISI][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |