| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
RESEARCH |
1 Division of Stem Cell Biology, Medical Research Center, MizMedi Hospital 701-4, Kangseo-ku, Seoul 157-280, Korea and 2 Department of Life Science, College of Natural Sciences, Hanyang University, Seoul, Korea
Correspondence should be addressed to H S Yoon; Email: yoon{at}mizmedi.net
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Maintaining mouse ESCs in an undifferentiated state requires the use of leukemia inhibitory factor and/or mitotically inactivated MEF feeder layers (Evans & Kaufman 1984, Smith et al. 1988, Willams et al. 1988, Roy et al. 2001). However, both feeder layers and basic fibroblast growth factor (bFGF) are needed to maintain the proliferation of hESCs (Thomson et al. 1998, Reubinoff et al. 2000, Park et al. 2003). MEF feeder cells have generally been used as feeder layers to support the unlimited growth of hESCs, but the use of animal feeder cells is associated with risks such as pathogen transmission and viral infection (Richards et al. 2002, Amit et al. 2003, 2004, Rosler et al. 2004). For these reasons hESCs cultured on animal feeder layers are not suitable for clinical applications. To overcome these problems, feeder layers comprising cells originating from human fetal and adult tissues have been tested. Some of the tested cells have allowed unlimited proliferation without differentiation, including human fetal skin fibroblasts, fallopian-tube epithelial cells (Richards et al. 2002), adult marrow cells (Cheng et al. 2003) and foreskin fibroblasts (Amit et al. 2003, Hovatta et al. 2003). Some of the human feeder cells supported the growth of hESCs in a similar way to MEF feeder cells. Richards et al.(2003) also reported the use of various primary cultured cells from human fetal, adult and neonatal tissues as feeder cells for supporting the growth of hESCs.
hESCs have also been cultured under serum- and/or feeder-free culture conditions. Xu et al.(2001) reported that hESCs are able to proliferate continuously on Matrigel (BD Biosciences, Bedfold, MA, USA) in MEF-conditioned medium (MEF-CM). Because extracellular matrices (ECMs) play multiple roles in the attachment, survival and growth of cells, Matrigel comprising laminin, collagen IV and heparan sulfate proteoglycan was used instead of MEF feeder layers. MEF-CM supporting the growth of hESCs in an undifferentiated state revealed the function of soluble factors secreted from MEF feeder cells. However, this culture protocol suffers from the need to maintain MEF cells in order to obtain MEF-CM and from the fact that Matrigel is also an animal product. There are some additional reports of hESCs grown under serum- and/or feeder-free culture conditions using feeder-CM or a growth cocktail (Amit et al. 2004, Carpenter et al. 2004, Rosler et al. 2004). Although hESCs maintained in these conditions exhibited typical morphology, marker expression and differentiation capacity, little is understood about the factors that regulate permanent growth without differentiation.
This study tested the use of three types of human cell (derived from uterine endometrium (hUECs), breast parenchyma (hBPCs) and abortus (hEFs)) as new feeder layers for supporting the unlimited growth of hESCs, and examined the characteristics of hESCs maintained on each human feeder layer.
| Materials and Methods |
|---|
|
|
|---|
(Sigma) and 10 U/ml DNAse I (Sigma) in Dulbeccos modified Eagles medium (DMEM)/F-12 (Gibco Invitrogen). Primary hBPCs were isolated from normal human breast tissues as previously described (Hahm & Ip 1990, Ricciardelli et al. 2002). In the process of hBPC isolation, collagenase IV was replaced by collagenase A (Roche) and hEF cells were isolated using a mechanical procedure only (Van Antwerp et al. 1996, Lee et al. 2000). The internal organs (e.g. intestine, liver and heart) were first removed from 13-week-old fetuses; organs were then homogenized into small pieces by gentle pipetting. Cells that were enzymatically or mechanically dissociated from each tissue were then plated onto culture flasks and prolonged culture was performed using DMEM/F-12 supplemented with 10% (v/v) fetal bovine serum (FBS; Hyclone, Logan, UT, USA), 4 mM glutamine (Gibco Invitrogen), 20 mM HEPES, 100 U/ml penicillin and 100 µg/ml streptomycin (Sigma). The cells were cultured until they passed through senescence. Cultured human primary cells were tested for the presence of infection by mycoplasmas and various viruses.
Preparation of feeder layers
Cultured primary human cells from each tissue were used as feeder cells from passage 3. These cells were mitotically inactivated using 10 µg/ml mitomycin C (Sigma) for 1.5 h and then washed three times with PBS. These cells were detached with 0.05% (v/v) trypsin and 0.53 mM EDTA (Gibco Invitrogen) and washed three times by centrifugation and resuspension with DMEM/F-12 medium. Dissociated cells were counted using a hemocytometer and were plated with DMEM/F-12 medium supplemented with 10% (v/v) FBS onto 0.1% (v/v) gelatin-coated four-well plates at 8.0 x 104 cells/well. After the attachment of plated cells, the medium was changed to DMEM/F-12 supplemented with 20% (v/v) knockout serum replacement (SR) (Gibco Invitrogen), 1 mM glutamine, 0.1 mM ß-mercaptoethanol (Sigma), 1% (v/v) non-essential amino acids and 4 ng/ml bFGF (Gibco Invitrogen).
hESC culture on human feeder layers
Miz-hES1 (NIH registered) was first established on mouse feeder layers. At passages 35, 50 and 30, hESCs maintained on MEF feeder layers were transferred onto hUEC, hBPC and hEF feeder layers respectively. hESCs cultured on each human feeder layer were passaged every 5 days by mechanical harvesting. About 45 h before the splitting of hESCs, the medium (DMEM/F-12 supplemented with 10% FBS) used to plate feeder cells was replaced by the medium for the culture of hESCs (DMEM/F-12, 20% SR), followed by a washing step. Prolonged culture of hESCs was performed at 37 °C in 5% CO2, with the culture medium being changed every day.
Characterization of hESCs adapted on human feeder cells
The morphology, expression of specific markers and differentiation capacity of hESCs cultured on each human feeder layer were examined. Cell morphology was observed under an inverted microscope every day and expressions of pluripotent cell-specific markers were tested immunocytochemically using stage-specific embryonic antigen (SSEA)-1 and -4 (Hybridoma Bank, University of Iowa, IA, USA), tumor rejection antigen (TRA)-1-81 (Chemicon, Temecula, CA, USA) and APase. Immunocytochemistry was performed as described by Park et al.(2003). Briefly, for APase staining, cultured cells were fixed by 4% (v/v) paraformaldehyde, permeabilized by 0.2% (v/v) Triton X-100 and stained using a kit containing 1 nitro blue tetrazolium chloride/S-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) as the substrate (Roche). In the process of SSEA-1 and -4 and TRA-1-81 staining, fixed cells were incubated with each primary antibody; antibody localization was performed using rabbit anti-mouse immunoglobulin secondary antibodies conjugated to fluorescein isothiocyanate or tetramethylrhodamine isothiocyanate (Jackson ImmunoResearch Laboratories, West Grove, PA, USA). Nuclei of each human feeder cell and hESC were visualized by the staining of Hoechst 33258.
To analyze the karyotypes of hESCs cultured on each human feeder cell, cell division was blocked by 0.1 µg/ml colcemid (GibcoBRL/Invitrogen) in metaphase for 12 h. Cells were then trypsinized and resuspended in hypotonic KCl solution (Sigma), incubated for 20 minutes at 37 °C and fixed with 3:1 methanol:acetic acid. Chromosomes were visualized using G-band staining. More than 100 cells were examined in this way.
The differentiation of hESCs maintained on human feeder layers was indicated by the formation of teratomas (in vivo) and embryoid bodies (EBs, in vitro). Mechanically dissociated hESC colonies were injected into the right testes of severe combined immune deficiency (SCID)-beige mice and PBS without hESCs was injected into the left testes as a negative control. Twelve weeks after the injection, teratomas were observed with hematoxylineosin staining. In vitro differentiation of hESCs was confirmed by the formation of EBs. To form EBs, feeder cells were removed and hESC colonies were harvested. Harvested colonies then transferred to EB culture medium (DMEM/F-12, 20% SR without bFGF), and the culture continued. After 2 weeks of culture, expressions of tissue-specific genes were examined by RT-PCR to confirm their differentiation capacity. Marker primers were used to test differentiation of hESCs into derivates of three embryonic germ layers: ectoderm (NF-68: forward, acgctgaggaatggttcaag; reverse, tagacgcctcaatggtttcc; keratin: forward, aggcccaatacgaggagatt; reverse, atagccactggagatggtgg), mesoderm (enolase: forward, gttcaatgtcatcaatggcg; reverse, gtgaacttctgccaagctcc; cartilage matrix protein (CMP): forward, aaaaagggcaatgacaccag; reverse, ttgtgcagtctctgaggtgg; kallikrein: forward, gctttctcagccaggacatc; reverse, tattctttgcctcccaggtg; cardiac actin (cATC): forward, tatttgctcccttgcttgga; reverse, cctaccccaaaaacaaacga;
-globin: forward, catggtgcatctgactcctg; reverse, gtacttgtgagccagggcat; ß-globin: forward, catggtgcatctgactcctg; reverse, gccaccactttctgataggc) and endoderm (albumin: forward, cttcctgggcatgtttttgt; reverse, ggttcaggaccacggataga;
1-antitrypsin (
1-AT): forward, actgtcaacttcggggacac; reverse, ccccattgctgaagacctta; PDX-1: forward, agctttacaaggacccatgc; reverse, ttcaacatgacagccagctc; insulin: forward, ccatagtcaggagatgggga; reverse, gctggtagagggagcagatg;
-fetoprotein (
-FP): forward, tgaaaaccctcttgaatgcc; reverse, tcttgcttcatcgtttgcag). Oct-4 (forward, aagaacatgtgtaagctgcggccc; reverse, ggaaaggcttcc ccctcagggaaagg) and ß-actin (forward, atctggcaccacaccttctacaatgagctgcg; reverse, cgtcattactcctgcttgctdatccacatctgc) were used as negative and positive control.
To analyze DNA contents of feeder cells and hESC colonies cultured on human feeder layers were harvested by trypsin-EDTA (Sigma) and 0.1% (v/v) collagenase type IV (Sigma); hESCs colonies were dissociated into single cells by treatment with 0.5 mM EDTA. Cells washed with PBS were fixed by 70% (v/v) ethanol for more than 1 h at 4 °C and washed thoroughly. To analyze the DNA content of hESCs, fixed cells were stained with 100 µg/ml propidium iodide (Sigma) containing 100 µg/ml Rnase and were measured by flow cytometry (EPICS ALTRA, Beckman Coulter, Miami, FL, USA). Proliferation of hESCs was also evaluated by using a 5-bromo-2'-deoxyuridine (BrdU) incorporation kit according to the manufacturers instructions (Roche). Briefly, hESCs were cultured in serum-starved medium (DMEM/F-12 supplemented with 0.1% SR) to synchronize cell cycle in the G1-stage for 36 h; they were then transferred to fresh medium (20% SR) and BrdU labeling solution for 4 h. Incorporated BrdU was localized using anti-BrdU working solution and was measured by ELISA reader (Microplate Manager; BioRad). Statistical analysis was performed using Students t-test.
| Results |
|---|
|
|
|---|
|
|
|
|
1-AT and
-FP) and ectoderm (NF-68) (Fig. 6B
|
|
|
| Discussion |
|---|
|
|
|---|
hESCs in an undifferentiated state exhibit a typical morphology of a high nucleus-to-cytoplasm ratio, prominent nucleoli and close spacing between cells. In previous studies the morphology of hESCs maintained on human feeder layers differed slightly from MEF-based hESCs (Amit et al. 2003, Cheng et al. 2003). We also found that the hESC colonies maintained on hUEC and hEF feeder layers were thinner and flatter than MEF- or hBPC-based hESC colonies. On the other hand, hBPC-based hESC colonies were denser than hESCs cultured on other feeder cells such as adult marrow cells (Cheng et al. 2003), and the hESCs (showing slightly different morphology) expressed SSEA-3 and -4, TRA-1-60 and 81, but not SSEA-1. In addition to these markers, proliferation activity was con-firmed by the immunocytochemical analysis of APase. As shown in Fig. 3
, hESC colonies cultured on each human feeder layer showed typical expression patterns such as being positive for SSEA-4, TRA-1-81 and APase, and negative for SSEA-1. These data indicate that the morphological changes do not affect the expression patterns of pluripo-tent cell-specific markers. As expected, human-feeder-based hESCs also have differentiation capacity; this was confirmed by the formation of teratomas and EBs. Human-feeder-based hESCs can differentiate into derivatives of all three embryonic germ layers. These results indicate that hESCs maintained on three different human feeder layers exhibited similar morphology, expression of specific markers and differentiation capacity.
hESCs cultured on human feeder layers of hUECs, hBPCs and bEFs were successfully grown as MEF-hESCs. Furthermore, MEF cells can maintain hESCs in an undifferentiated state only until passage 5, whereas human feeder cells from each of the tissues we tested can be used to support the growth of hESCs until they pass through senescence. This advantage may prove helpful in controlling the growth and differentiation of hESCs that express various embryotrophic factors in each human feeder layer. It is known that hUECs support the growth of cleaving embryos and induce successful implantation. In this process, hUECs express various factors including cell adhesion molecules, growth factors and cytokines that have critical roles in embryo proliferation, attachment and invasion (Aplin 1997, Lessey 2000, Selam et al. 2002, Nardo et al. 2003). Many factors that regulate the growth of cells are also expressed from not only hUECs but also hBPCs (Imagawa et al. 2002, Palmieri et al. 2003) and hEFs (Ellis et al. 1997, Chang et al. 2002). The various factors expressed in each cell type may have an important role in inducing the growth and inhibiting the differentiation of hESCs.
hUECs repeatedly proliferate and differentiate throughout the menstrual cycle, under hormonal regulation. In this experiment, hUECs used to support the growth of hESCs were obtained from three patients. Two (Miz-endo1 and -2) out of three hUEC lines were isolated at proliferative phase and one cell line (Miz-endo3) was isolated in luteal phase. Mitotically inactivated Miz-endo1 and -2, isolated at proliferative phase, can support the continuous growth of hESCs as MEF feeder cells can, but Miz-endo3 cannot. In addition to supporting the maintenance of hESCs, Miz-endo1 can support the establishment of hESC lines. Miz-hES9, -14 and -15 were established and have been expanded on hUEC feeder layers and three hESC lines showed typical hESC properties (Lee et al. 2004). These results suggest that the phase of endometrial cells might be one of the important factors when hUECs are used as feeder cells to keep hESCs in an undifferentiated stage.
For the eventual application in cell replacement therapy, hESCs should be established and maintained under stable xeno-free culture conditions. Thus, many stem cell researchers have tried to eliminate animal materials for the establishment and culture of hESCs. However, the xeno-free culture condition is not yet complete because animal materials have still been used in the process of ICM isolation (anti-human-serum antibody and guinea-pig complement), feeder cell culture (animal serum) and hESC culture (animal serum or SR containing albumin purified from animals). Our results demonstrate that hESCs can be maintained on human feeder cells without direct interaction with animal cells and animal serum. However, our culture condition still has the risks of pathogen transmission and viral infection because FBS was used for the culture of each feeder cell and SR used for the maintenance of hESCs contains bovine albumin. Therefore, it is necessary to establish and culture hESCs using human serum to overcome the contamination of animal resources for cell replacement therapy with a stable xeno-free culture protocol.
More effective human feeder cells should be selected by comparing each type of feeder cell for the expression of various factors that are related to the induction of proliferation and the inhibition of differentiation of hESCs such as ECMs, growth factors and cytokines. hESCs established on the most effective human feeder cells will promote the development of cell-based therapies.
| Acknowledgements |
|---|
|
|
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Amit M, Margulets V, Segev H, Shariki K, Laevsky I, Coleman R & Itskovitz-Eldor J 2003 Human feeder layers for human embryonic stem cells. Biology of Reproduction 68 21502156.
Amit M, Shariki C, Margulets V & Itskovitz-Eldor J 2004 Feeder layer- and serum-free culture of human embryonic stem cells. Biology of Reproduction 70 837845.
Aplin JD 1997 Adhesion molecules in implantation. Reviews of Reproduction 2 8493.[Abstract]
Apparao KB, Lovely LP, Gui Y, Lininger RA & Lessey BA 2002 Elevated endometrial androgen receptor expression in women with polycystic ovarian syndrome. Biology of Reproduction 66 297304.
Carpenter MK, Rosler ES, Fisk GJ, Brandenberger R, Ares X, Miura T, Lucero M & Rao MS 2004 Properties of four human embryonic stem cell lines maintained in a feeder-free culture system. Developmental Dynamics 229 243258.[CrossRef][Web of Science][Medline]
Chang HY, Chi J, Dudoit S, Bondre C, Rijn M, Botstein D & Brown PO 2002 Diversity, topographic differentiation, and positional memory in human fibroblasts. PNAS 99 1287712882.
Cheng L, Hammond H, Ye Z, Zhan X & Dravid G 2003 Human adult marrow cells support prolonged expansion of human embryonic stem cells in culture. Stem Cells 21 131142.
Ellis I, Banyard J & Schor SL 1997 Differential response of fetal and adult fibroblasts to cytokines: cell migration and hyaluronan synthesis. Development 124 15931600.[Abstract]
Evans MJ & Kaufman MH 1984 Establishment in culture of pluripotential cells from mouse embryos. Nature 292 154156.
Hahm HA & Ip MM 1990 Primary culture of normal rat mammary epithelial cells within a basement membrane matrix. I. Regulation of proliferation by hormones and growth factors. In Vitro Cell Developmental Biology 26 791802.[Web of Science][Medline]
Hovatta O, Mikkola M, Gertow K, Strömberg A, Inzunza J, Hreinsson J, Rozell B, Andäng M & Ährlund-Richter L 2003 A culture system using human foreskin fibroblasts as feeder cells allows production of human embryonic stem cells. Human Reproduction 18 14041409.
Imagawa W, Pedchenko VK, Helber J & Zhang H 2002 Hormone/ growth factor interactions mediating epithelial/stromal communication in mammary gland development and carcinogenesis. Journal of Steroid Biochemistry and Molecular Biology 80 213230.[CrossRef][Web of Science][Medline]
Lee PP, Hwang JJ, Murphy G & Ip MM 2000 Functional significance of MMP-9 in tumor necrosis factor-induced proliferation and branching morphogenesis of mammary epithelial cells. Endocrinology 141 37643773.
Lee JB, Lee JE, Park JH, Kim SJ, Kim MK, Roh SI & Yoon HS 2004 Establishment and maintenance of human embryonic stem cell lines on human feeder cells derived from uterine endometrium under serum-free condition. Biology of Reproduction (In Press).
Lessey BA 2000 The role of the endometrium during embryo implantation. Human Reproduction Supplement 6 3950.
Nardo LG, Nikas G & Makrigiannakis A 2003 Molecules in blastocyst implantation. Role of matrix metalloproteinases, cytokines and growth factors. Journal of Reproductive Medicine 48 137147.[Web of Science][Medline]
Palmieri C, Roberts-Clark D, Assadi-Sabet A, Coope RC, OHare M, Sunters A, Hanby A, Slade MJ, Gomm JJ, Lam EW & Coombes RC 2003 Fibroblast growth factor 7, secreted by breast fibroblasts, is an intereukin-1 beta-induced paracrine growth factor for human breast cells. Journal of Endocrinology 177 6581.[Abstract]
Park JH, Kim SJ, Oh EJ, Moon SY, Roh SI & Yoon HS 2003 Establishment and maintenance of human embryonic stem cells on STO, a permanently growing cell line. Biology of Reproduction 69 20072014.
Reubinoff BE, Pera MF, Fong CY, Trounson A & Bongso A 2000 Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nature Biotechnology 18 399404.[CrossRef][Web of Science][Medline]
Ricciardelli C, Brooks JH, Suwiwat S, Sakko AJ, Mayne K, Raymond WA, Seshadri R, LeBaron RG & Horsfall DJ 2002 Regulation of stromal versican expression by breast cancer cells and importance to relapse-free survival in patients with nodenegative primary breast cancer. Clinical Cancer Research 8 10541060.
Richards M, Fong CY, Chan WK, Wong PC & Bongso A 2002 Human feeders support prolonged undifferentiated growth of human inner cell masses and embryonic stem cells. Nature Biotechnology 20 933936.[CrossRef][Web of Science][Medline]
Richards M, Tan S, Fong CY, Biswas A, Chan WK & Bongso A 2003 Comparative evaluation of various human feeders for prolonged undifferentiated growth of human embryonic stem cells. Stem Cells 21 546556.
Rosler ES, Fisk GJ, Ares X, Irving J, Miura T, Rao MS & Carpenter MK 2004 Long-term culture of human embryonic stem cells in feeder-free conditions. Developmental Dynamics 229 259274.[CrossRef][Web of Science][Medline]
Roy A, Krzykwa E, Lemieux R & Neron S 2001 Increased efficiency of
-irradiated versus mitomycin C-treated feeder cells for the expansion of normal human cells in long-term cultures. Journal of Hematotherapy and Stem Cell Research 10 873880.
Selam B, Kayisli UA, Garcia-Valasco JA & Arici A 2002 Extracellular matrix-dependent regulation of Fas ligand expression in human endometrial stromal cells. Biology of Reproduction 66 15.
Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, Stahl M & Rogers D 1988 Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 336 688690.[CrossRef][Medline]
Telgmann R, Maronde E, Tasken K & Gellersen B 1997 Activated protein kinase A is required for differentiation-dependent transcription of the decidual prolactin gene in human endometrial stromal cells. Endocrinology 138 929937.
Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS & Jones JM 1998 Embryonic stem cell lines derived from human blastocysts. Science 282 11451147.
Van Antwerp DJ, Martin SJ, Kafri T, Green DR & Verma IM 1996 Suppression of TNF-alpha-induced apoptosis by NF-kappaB. Science 274 787789.
Williams RL, Hilton DJ, Pease S, Willson TA, Stewart CL, Gearing DP, Wagner EF, Metcalf D, Nicola NA & Gough NM 1988 Myeloid leukemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 336 684687.[CrossRef][Medline]
Xu C, Inokuma MS, Denham J, Golds K, Kundu P, Gold JD & Carpenter MK 2001 Feeder-free growth of undifferentiated human embryonic stem cells. Nature Biotechnology 19 971974.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
S. Ilancheran, A. Michalska, G. Peh, E. M Wallace, M. Pera, and U. Manuelpillai Stem Cells Derived from Human Fetal Membranes Display Multilineage Differentiation Potential Biol Reprod, September 1, 2007; 77(3): 577 - 588. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-T. Chen, W. Li, Y. Hayashida, H. He, S.-Y. Chen, D. Y. Tseng, A. Kheirkhah, and S. C. G. Tseng Human Amniotic Epithelial Cells as Novel Feeder Layers for Promoting Ex Vivo Expansion of Limbal Epithelial Progenitor Cells Stem Cells, August 1, 2007; 25(8): 1995 - 2005. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Olsen, D. L. Stachura, and M. J. Weiss Designer blood: creating hematopoietic lineages from embryonic stem cells Blood, February 15, 2006; 107(4): 1265 - 1275. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |