Reproduction  
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS  

Reproduction (2004) 128 565-571
DOI: 10.1530/rep.00325
Copyright © 2004 Society for Reproduction and Fertility
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Everett, C. A
Right arrow Articles by West, J. D
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Everett, C. A
Right arrow Articles by West, J. D

RESEARCH

Genetic influences on ovulation of primary oocytes in LT/Sv strain mice

Clare A Everett1,2, Catherine A Auchincloss1, Matthew H Kaufman3, Catherine M Abbott1 and John D West2

1 Medical Genetics, Molecular Medicine Centre, University of Edinburgh, Western General Hospital, Crewe Road, Edinburgh EH4 2XU, UK, 2 Division of Reproductive and Developmental Sciences, Genes and Development Group, University of Edinburgh, Hugh Robson Building, George Square, Edinburgh EH8 9XD, UK and 3 Division of Biomedical Sciences, Genes and Development Group, University of Edinburgh, Hugh Robson Building, George Square, Edinburgh EH8 9XD, UK

Correspondence should be addressed to John West; Email: John.West{at}ed.ac.uk


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
A high proportion of LT/Sv strain oocytes arrest in meiotic metaphase I (MI) and are ovulated as diploid primary oocytes rather than haploid secondary oocytes. (Mus musculus castaneus x LT/SvKau)F1 x LT/SvKau backcross females were analysed for the proportion of oocytes that arrested in MI and typed by PCR for a panel of microsatellite DNA sequences (simple sequence repeat polymorphisms) that differed between strain LT/SvKau and M. m. castaneus. This provided a whole genome scan of 86 genetic markers distributed over all 19 autosomes and the X chromosome, and revealed genetic linkage of the MI arrest phenotype to markers on chromosomes 1 and 9. Identification of these two chromosomal regions should facilitate the identification of genes involved in mammalian oocyte maturation and the control of meiosis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
The inbred mouse strain LT/Sv is unusual in ovulating a high proportion of its oocytes prematurely as primary oocytes at meiotic metaphase I (MI), rather than secondary oocytes at meiotic metaphase II (MII) (Kaufman & Howlett 1986, O’Neill & Kaufman 1987, Spiers & Kaufman 1990, Eppig & Wigglesworth 1994, Maleszewski & Yanagimachi 1995), and producing a high frequency of ovarian teratomas (Stevens & Varnum 1974, Eppig et al. 1977). These primary oocytes may be activated parthenogenetically and begin development (Stevens & Varnum 1974, Anderson et al. 1984, Kaufman & Howlett 1986, Maleszewski & Yanagimachi 1995, Eppig et al. 1996) or they may be fertilised to produce dygynic triploid embryos (Kaufman & Speirs 1987, O’Neill & Kaufman 1987, Maleszewski & Yanagimachi 1995). The MI arrest occurs in LT/Sv oocytes denuded of cumulus cells (Ciemerych & Kubiak 1998), and experiments with chimeric reconstituted ovaries showed that MI arrest in the related strain LTXBO was a consequence of the genotype of the oocyte rather than the surrounding follicle cells (Eppig et al. 2000). MI arrest occurred frequently in LTXBO oocytes surrounded by wild-type follicle cells, but not in the reciprocal combination.

The control of meiosis is a complex process involving many genes, some of which have been identified (Sagata 1997, Taieb et al. 1997, Schafer 1998, Stojkovic et al. 1999), but the primary genetic defect in LT/Sv strain mice remains unknown. M-phase promoting factor, MPF (previously known as maturation promoting factor), plays an important role in both meiotic and mitotic cell cycles, whereas cytostatic factor (CSF) is specifically associated with meiosis and is responsible for the normal arrest of oocytes at meiotic metaphase II. MPF is a protein kinase, consisting of a heterodimer of Cdc2 kinase and cyclin B (regulatory subunit), and it phosphorylates and regulates proteins involved in cell division. MPF activity varies according to the stage of the cell cycle. It increases at the end of each interphase and drives the cell into metaphase, but cyclin B is destroyed at anaphase, so MPF levels fall as the cell exits M-phase and enters the next interphase. CSF involves the action of Mos (Moloney sarcoma oncogene protein), a serine/threonine protein kinase, and evidence from Mos / knockouts showed that Mos activates MAPK (mitogen-activated protein kinase), a key component of CSF (Araki et al. 1996, Verlhac et al. 1996). Activation of MAPK by Mos involves an activation cascade: Mos activates MAPK kinase kinase, which activates MAPK kinase, which, in turn, activates MAPK. CSF (Mos-MAPK) is produced only during meiosis and is involved in stabilising MPF. MAPK, induced by Mos, may act to inhibit cyclin B degradation and so sustain high levels of MPF and cause MII arrest (Hirao & Eppig 1997). At fertilisation, CSF is degraded, so MSF levels fall and allow the oocyte to complete the second meiotic division.

The involvement of Mos in the normal MII arrest suggested that Mos might also be involved in the abnormal MI arrest of LT/Sv oocytes. In LT/Sv oocytes arrested in MI, cyclin B1 and MPF fail to decline (Hampl & Eppig 1995), which is consistent with the possibility that the MI arrest occurs because CSF stabilises MPF prematurely in MI LT/Sv oocytes (West et al. 1993). However, experimental evidence suggests Mos is involved in maintaining this abnormal MI arrest, but not in initiating it (Hirao & Eppig 1997), and that the MI arrest of LT/Sv is caused by delayed transition from metaphase-I to anaphase-I rather than direct involvement of CSF (Ciemerych & Kubiak 1998). A more recent study suggests that the delayed entry into anaphase-I (MI arrest) seen in LT/Sv oocytes involves abnormalities in regulation of protein kinase C (PKC) (Viveiros et al. 2001).

A genetic approach may help uncover the primary defect(s) responsible for the meiotic abnormality in LT/Sv oocytes. Genetic crosses between LT/SvKau and C57BL/Ws strain mice were compatible with segregation of a co-dominant autosomal gene (with incomplete penetrance and variable expressivity) that has a major influence on the incidence of ovulation of primary oocytes (West et al. 1993). This putative gene was given the provisional name primary oocyte ovulation (provisional gene symbol Poo). However, analysis of recombinant inbred strains, derived from the progenitor strains of LT/Sv mice (C58/J and BALB/cJ), implied that both MI arrest and parthenogenetic activation were controlled by more than one gene (Eppig et al. 1996). As Eppig et al.(1996) point out, these conflicting results can be reconciled if LT/SvKau and C57BL/Ws strains differ for alleles of Poo but both carry the same alleles of one or more genes that are necessary but insufficient to induce MI arrest.

The present study was undertaken to try to map the gene or genes responsible for the MI arrest that leads to ovulation of primary oocytes in LT/Sv mice, to help uncover the primary molecular and cellular defect(s) responsible for this meiotic abnormality.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Mice
Inbred LT/SvKau and C57BL/Ws mice were bred under conventional conditions in the Centre for Reproductive Biology, University of Edinburgh. Mus musculus castaneus mice of strain CAST/Ei were obtained from the MRC Human Genetics Unit, Edinburgh, and genetic crosses were set up at the Centre for Reproductive Biology. (CAST x LT/SvKau)F1 x LT/SvKau backcross females and (C57BL/Ws x LT/SvKau)F1 x LT/SvKau backcross females were produced for analysis. (Female mice are shown first for all genetic crosses.)

Cytogenetic analysis of oocytes
Oocytes from (C57BL/Ws x LT/SvKau)F1 x LT/SvKau back-cross females were analysed after maturation in vivo, essentially as described previously (West et al. 1993). Oocytes in the main experiment using (CAST x LT/SvKau)F1 x LT/SvKau backcross females were analysed cytogenetically after in vitro culture as described by Everett and Searle (1995). Female mice were injected with 5 IU pregnant mares’ serum gonadotrophin (PMS) at 1200 h. Approximately 45 h later, ovaries were dissected into M2 handling medium in a solid watch glass, trimmed of fat and pricked with 25G needles to burst the follicles. The oocytes were freed from the follicles and cleaned of most of the adhering cumulus cells. Germinal vesicle stage oocytes were collected with a micropipette, transferred to a drop of M2 handling medium and then to several wash drops of M16 culture medium (Whittingham 1971), pre-equilibrated in 5% CO2 in air at 37 °C, and finally transferred to a culture drop of M16 culture medium under liquid paraffin oil in a Petri dish. After overnight culture for approximately 17 h at 37 °C in 5% CO2 in air (during which time the oocytes underwent germinal vesicle breakdown), chromosome preparations were made. The oocytes were transferred to M2 handling medium, ensuring that no paraffin oil remained on the surface of the drop, and then a few at a time were transferred to a drop of freshly made 1% sodium citrate. Within 10 min, the oocytes appeared swollen and were transferred to a clean glass microscope slide in the smallest possible volume of sodium citrate. A drop of freshly prepared ethanol:acetic acid (3:1) fixative was dropped onto the drop of sodium citrate containing the oocytes and air dried. The slides were post-fixed in 3:1 fixative for 30 min, rinsed in tap water, hydrolysed in 0.5 M HCl for 30 min, rinsed in tap water and stained with Giemsa. MI oocytes were identified cytogenetically as those with chiasmata.

Genetic analysis
This genetic trait is difficult to analyse because it shows incomplete penetrance and variable expressivity (West et al. 1993). We considered that it would be unreliable to estimate a quantitative value from the proportion of MI oocytes ovulated by each female because the number of analysable oocytes was small and varied among females. Instead, we followed the approach used previously with this trait (West et al. 1993) and classified each female according to whether the proportion of MI oocytes ovulated was above the normal range.

Spleens of all females used for oocyte collections were stored at –70 °C and used for DNA preparations. Analysis of genetic linkage and calculation of LOD scores was performed with Map Manager 2.6.5 (Manly 1993). Several candidate genes (including Mos, gdf9, bcl2, Omt2a and Omt2b) were sequenced from LT/SvKau and other strains by standard techniques.

Microsatellite polymorphisms (Dietrich et al. 1992) were analysed in the mapping studies by standard methodology and are listed in Table 1Go. All markers were typed by primers as described in MGI (mouse genome informatics; www.informatics.jax.org/) apart from D_Abb markers, indicated with an asterisk (*). These were developed by C.A. Auchincloss and C.M. Abbott (unpublished) and had been previously mapped with the Jackson Laboratory Inter-specific Backcross panels (http://www.jax.org/resources/documents/cmdata/). Primer sequences are given below. The Mt3 PCR assay was as described in Abbott and Chambers (1994).


View this table:
[in this window]
[in a new window]
 
Table 1 Location of DNA markers used for analysis of (CAST x LT/SvKau)F1 x LT/SvKau backcross female mice.
 
Primers for D3Abb3 are 5'GTGGCGTCCCACTCTTGG 3'and 5'CACAGAGGACTGGCAAAGC 3'(product size 190 bp); those for D6Abb4 are 5'GTTACTCCTGGAGGG-CAACA 3'and 5'GAACGTGCTGACAGGGATAC 3'(product size 262 bp); those for D6Abb7 are 5'TGGAAGGTT-TATGCCCACA 3'and 5'CACACATTGTTTGCTTTCCAA 3' (product size 261 bp): those for D15Abb2 are 5'TCCGAG-CCTAGCTCGTAGTC 3'and 5'GGGAAAAGGAAAACCT-GCTC 3'(product size 201 bp); and those for DXAbb2 are 5'AGTGAGCAAGGGGAGGTCTT 3'and 5'TGTGTAGCT-CCACGTCTGGT 3'(product size 256 bp).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
Analysis of (C57BL/Ws x LT/SvKau)F1 x LT/SvKau backcross females
A preliminary mapping study of (C57BL/Ws x LT/SvKau) F1 x LT/SvKau backcross females was undertaken to try to map the gene or genes responsible for the MI oocyte arrest in LT/Sv mice. The strain combination was the same as in our earlier study (West et al. 1993), and, as before, oocytes were matured and ovulated in vivo. Seventy-three of 154 backcross females produced over 10 scoreable oocytes, and 52 were classified as either heterozygous or LT phenotype for ovulation of MI oocytes. A total of 59 marker simple sequence repeats (SSRs) distributed over all 19 autosomes and the X chromosome was used to provide a limited whole-genome scan. No significant association was found between the frequency of metaphase I arrest and strain of origin for any of the 59 polymorphic markers, so more effort was focused on a new backcross involving M. m. castaneus mice, for which more polymorphic SSRs were available.

Frequency of LT/Sv, CAST, F1 and backcross females producing MI arrested oocytes
M. m. castaneus (CAST) mice were used to try to maximise the genetic differences with LT/SvKau and so maximise the number of DNA linkage markers available for analysis. Oocytes were matured in vitro because with this method more females produced at least 10 scoreable oocytes than with the in vivo method used earlier (30–40% versus approximately 25%). The overall frequency of MI-arrested oocytes produced by the parental strains was 55.6% (59/106) from 19 LT/SvKau females, 4.3% (1/23) from 6 CAST females and 3.3% (3/92) from 9 (CAST x LT)F1 hybrid females. The distributions of these control females, producing different frequencies of MI-arrested oocytes, is shown in Fig. 1Go. These show a good discrimination between LT and CAST females, with LT strain females producing >30% and homozygous wild-type CAST females producing ≤10% MI-arrested oocytes. The F1 females were more similar to CAST than LT, which is compatible with recessive inheritance or the type of co-dominant inheritance suggested by West et al.(1993).



View larger version (10K):
[in this window]
[in a new window]
 
Figure 1 Distributions of control females (parental strains and F1 hybrids), grouped according to frequency of MI-arrested oocytes produced. (a) LT females, (b) CAST females, (c) (CAST x LT)F1 females.

 
Oocytes from 177 (CAST x LT)F1 x LT backcross females were analysed cytogenetically, and 99 of these produced more than 10 analysable oocytes. Another four females produced only 9 oocytes but were classified as phenotypically heterozygous, rather than LT, because all 9 were MII oocytes. (Even if the tenth oocyte was arrested in MI, the percentage of MI-arrested oocytes would not have exceeded 10%.) Similarly, another 21 females that produced under 10 oocytes were classified as LT phenotype because, even if a total of 10 oocytes was reached by adding only MII oocytes, they would have produced over 10% MI-arrested oocytes. Overall, 19.7% of 1532 oocytes from these 124 females were arrested in MI. The distribution of these 124 (CAST x LT)F1 x LT backcross females producing different frequencies of MI arrested oocytes was bimodal (Fig. 2aGo).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 2 Distributions of 124 (CAST x LT)F1 x LT backcross females grouped according to frequency of MI-arrested oocytes produced. Ninety-nine females produced more than 10 analysable oocytes (black bars), and 25 others (hatched bars) were added, using criteria discussed in the text. (a) Backcross females are grouped with the same intervals used for control females in Fig. 1Go. (b) Backcross females were divided into three groups by the final criteria that heterozygous females produced <10% MI oocytes and LT produced ≥ 25 MI oocytes.

 
Seventeen of these 124 backcross females produced 10–24% MI-arrested oocytes and were excluded as unclassifiable, leaving 107 classified (CAST x LT)F1 x LT backcross females, which produced a total of 1308 analysable oocytes. Fifty-four females produced <10% MI-arrested oocytes (classified as heterozygous phenotype), and 53 females produced ≥25% MI-arrested oocytes (Fig. 2bGo). This is close to the 1:1 ratio expected for segregation of a single gene.

Mapping meiotic abnormality genes in the (CAST x LT/SvKau)F1 x LT/SvKau backcross
All 124 (CAST x LT/SvKau)F1 x LT/SvKau backcross females were analysed for both the proportion of oocytes that arrested in MI and a panel of microsatellite DNA sequences (polymorphic SSRs) that differed between strains LT/SvKau and CAST. As described above, cyto-genetic analysis of oocytes enabled 107 of the 124 females to be classified as either heterozygous or LT in phenotype, so only these females were included in the subsequent linkage analysis.

PCR was used to distinguish between microsatellite polymorphisms characteristic of LT and CAST mice, and provided a whole genome scan to identify putative genes associated with the MI arrest phenotype (Dietrich et al. 1992). A series of 49 SSR microsatellites distributed over all 19 autosomes and the X chromosome was used initially, and genetic recombination, between the LT MI arrest phenotype and LT SSR polymorphisms, at a frequency significantly lower than the expected 50% value (chi-square test) was taken as preliminary evidence of genetic linkage. This preliminary analysis revealed three SSRs on chromosomes 1, 9 and 17 that could be linked to the MI arrest phenotype, suggesting that three loci may be associated with the meiotic anomaly in female LT/SvKau mice.

A further 37 markers were scored in order to provide better coverage of the genome and to focus more attention on chromosomes 1, 9 and 17 to try to locate the putative genes associated with the MI arrest phenotype. These included 12 D1Mit markers, 6 D9Mit markers and 5 D17Mit markers, making a total of 16 markers on chromosome 1, 9 on chromosome 9 and 7 on chromosome 17. The locations of the 86 markers used are shown in Table 1Go. It was difficult to assign precise genetic recombination frequencies because of the nature of the genetic trait, but LOD scores were used to evaluate putative genetic linkages.

For chromosome 1, the tightest linkage was demonstrated for marker D1Mit306 located 58.7cM from the centromere, which showed a recombinant fraction (RF) of 28.0 ± 4.3% (30/107) which was significantly less than the 50% expected for non-linkage ({chi}2 =20.64; P < 0.001) and produced a LOD score of 5.0 (Fig. 3Go). According to the criteria of Lander and Kruglyak (1995) for backcross mice, LOD scores of 1.9 and 3.3 are associated with suggestive and significant linkage respectively. Thus, this chromosome 1 locus shows a significant linkage with the metaphase I arrest phenotype in LT/SvKau mice.



View larger version (21K):
[in this window]
[in a new window]
 
Figure 3 LOD scores for the chromosome 1 markers used and their map positions, showing a maximum LOD score for marker D1Mit306 at 58.7 cM. Seven candidate genes and their map locations are shown to the left of the chromosome diagram. The names of candidate genes listed are as follows: Mtap, microtubule-associated protein; Kif22b and Kif21b, kinesin family member; Ncl, nucleolin-processing RNA; Serpine2 (Spi), serine protease inhibitor (nexin); Bcl2, B-cell leukaemia/lymphoma 2; Psmb6-rs1, processed pseudo-gene (proteasome subunit). Map positions are shown as genetic distances from the centromere in cM, according to MGI (www.informatics.jax.org/).

 
For chromosome 9, the tightest linkage was demonstrated for marker D9Mit181 located at 48.0cM, which showed a statistically significant recombinant fraction (RF =33.6 ± 4.6% (36/107); {chi}2 =11.45; P < 0.001) and produced a LOD score of 2.5 (Fig. 4Go). According to the above criteria, this chromosome 9 locus shows only suggestive linkage with the metaphase I arrest phenotype. For chromosome 17, the tightest linkage was demonstrated for marker D17Mit209. Although preliminary analysis suggested this may be significant (RF =39.3 ± 4.7% (42/107); {chi}2 =4.94; P < 0.05), it failed to produce a significant LOD score, so is unlikely to be associated with the meiotic anomaly in LT/SvKau mice.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4 LOD scores for the chromosome 9 markers used and their map positions, showing a maximum LOD score for marker D9Mit181 at 48.0 cM. Seven candidate genes and their map locations are shown to the left of the chromosome diagram. The names of candidate genes listed are as follows: Oriq1, ovulation rate QTL; Map2k1, mitogen-activated protein kinase 1 (MAP kinase 1); Omt2a and Omt2b, oocyte maturation; Bcl2a1a, B-cell leukaemia/lymphoma 2-related protein A1a; Mtap4, microtubule-associated protein 4; Cdc25a, cell division cycle 25A.

 
Candidate genes on chromosomes 1 and 9
The incomplete penetrance and variable expressivity shown by this trait makes it difficult to map the gene(s) with precision. As a consequence, the putative loci on chromosomes 1 and 9 have not been located precisely, and a number of candidate genes remain possible. DNA sequences of several candidate genes (including Mos, gdf9, bcl2, Omt2a and Omt2b) were compared for LT/SvKau and other strains, but no differences were found. These genes were selected because of their known effects on meiosis, reproduction or the cell cycle, and/or because they map to relevant regions of the genome.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
The genetic mapping of the meiotic abnormality that causes some LT/SvKau oocytes to arrest at the first meiotic metaphase and be ovulated as primary oocytes is difficult because it shows incomplete penetrance and variable expressivity. However, the (CAST x LT/SvKau)F1 x LT/SvKau backcrosses showed that it is associated with a region of chromosome 1 and probably a region of chromosome 9.

Although markers on chromosomes 1 and 9 were included in the preliminary analysis of (C57BL/Ws x LT/SvKau)F1 x LT/SvKau backcross females, no significant linkage was found. The reason for this is unclear, but the small number of animals used would have been a contributing factor.

Our genetic evidence supports other experimental evidence that Mos is not affected in LT/Sv mice (see Introduction). DNA sequencing of the Mos allele in LT/SvKau mice revealed no mutations in the coding region, and the mapping study showed no association between the MI oocyte arrest trait and the markers tested on chromosome 4, where Mos is located. As noted in the Introduction, there is evidence that the delayed entry into anaphase-I (MI arrest) seen in LT/Sv oocytes involves abnormalities in regulation of protein kinase C (PKC) (Viveiros et al. 2001). A number of Prkc genes have been mapped, but none map to the appropriate region of chromosomes 1 or 9. Prkcsh (protein kinase C, substrate 80K-H) is on chromosome 9 but is at 6.0 cM, which is outside the critical region. Moreover, Prkce (protein kinase C, epsilon) and Prkcn (protein kinase C, nu) are located on chromosome 17.

The identification of a region of chromosome 1 and another possible region of chromosome 9 that are associated with the MI arrest of LT/Sv mice should help narrow the search for the primary molecular and cellular defect(s) responsible for this meiotic abnormality.


    Acknowledgements
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 
We thank Doreen M. Chambers, Margaret A. Keighren and Jean H Flockhart for technical assistance, and Denis Doogan, Maureen Ross and Jim Macdonald for expert mouse husbandry. We are grateful to the Wellcome Trust for financial support (grant 046822/Z/96/Z to JDW, MHK and CMA).


    Footnotes
 
Received 21 May 2004
First decision 30 July 2004
Accepted 3 August 2004


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 Acknowledgements
 References
 

Abbott C & Chambers D 1994 Analysis of CAG trinucleotide repeats from mouse cDNA sequences. Annals of Human Genetics 58 87–94.[Web of Science][Medline]

Anderson E, Hoppe PC & Lee GS 1984 The karyotype and ultrastructural characteristics of spontaneous preimplantation mouse parthenotes. Gamete Research 9 451–467.[CrossRef][Web of Science]

Araki K, Naito K, Haraguchi S, Suzuki R, Yokoyama M, Inoue M, Aizawa S, Toyoda Y & Sato E 1996 Meiotic abnormalities of c-mos knockout mouse oocytes: activation after first meiosis or entrance into third meiotic metaphase. Biology of Reproduction 55 1315–1324.[Abstract]

Ciemerych MA & Kubiak JZ 1998 Cytostatic activity develops during meiosis I in oocytes of LT/Sv mice. Developmental Biology 200 198–211.[CrossRef][Web of Science][Medline]

Dietrich W, Katz H, Lincoln SE, Shin HS, Friedman J, Dracopoli NC & Lander ES 1992 A genetic map of the mouse suitable for typing intraspecific crosses. Genetics 131 423–447.[Abstract]

Eppig JJ & Wigglesworth K 1994 Atypical maturation of oocytes of strain I/LnJ mice. Human Reproduction 9 1136–1142.[Abstract/Free Full Text]

Eppig JJ, Kozak LP, Eicher EM & Stevens LC 1977 Ovarian teratomas in mice derived from oocytes that have completed the 1st meiotic division. Nature 269 517–518.[CrossRef][Medline]

Eppig JJ, Wigglesworth K, Varnum DS & Nadeau JH 1996 Genetic regulation of traits essential for spontaneous ovarian teratocarcino-genesis in strain LT/Sv mice: aberrant meiotic cell cycle, oocyte activation, and parthenogenetic development. Cancer Research 56 5047–5054.[Abstract/Free Full Text]

Eppig JJ, Wigglesworth K & Hirao Y 2000 Metaphase I arrest and spontaneous parthenogenetic activation of strain LTXBO oocytes: chimeric reaggregated ovaries establish primary lesion in oocytes. Developmental Biology 224 60–68.[CrossRef][Web of Science][Medline]

Everett CA & Searle JB 1995 Pattern and frequency of nocodazole induced meiotic nondisjunction in oocytes of mice carrying the tobacco mouse metacentric Rb(16.17)7Bnr. Genetical Research 66 35–43.[Web of Science][Medline]

Hampl A & Eppig JJ 1995 Analysis of the mechanism(s) of metaphase I arrest in maturing mouse oocytes. Development 121 925–933.[Abstract]

Hirao Y & Eppig JJ 1997 Analysis of the mechanism(s) of metaphase I arrest in strain LT mouse oocytes: participation of MOS. Development 124 5107–5113.[Abstract]

Kaufman MH & Howlett SK 1986 The ovulation and activation of primary and secondary oocytes in LT/Sv strain mice. Gamete Research 14 255–264.[CrossRef][Web of Science]

Kaufman MH & Speirs S 1987 The postimplantation development of spontaneous digynic triploid embryos in LT/Sv strain mice. Development 101 383–391.[Abstract]

Lander E & Kruglyak L 1995 Genetic dissection of complex traits –guidelines for interpreting and reporting linkage results. Nature Genetics 11 241–247.[CrossRef][Web of Science][Medline]

Maleszewski M & Yanagimachi R 1995 Spontaneous and sperm-induced activation of oocytes in LT/Sv strain mice. Development, Growth and Differentiation 37 679–685.[CrossRef]

Manly KF 1993 A Macintosh program for storage and analysis of experimental genetic-mapping data. Mammalian Genome 4 303–313.

O’Neill GT & Kaufman MH 1987 Ovulation and fertilization of primary and secondary oocytes in LT/Sv strain mice. Gamete Research 18 27–36.[CrossRef][Web of Science][Medline]

Sagata N 1997 What does Mos do in oocytes and somatic cells? Bioessays 19 13–21.[CrossRef][Web of Science][Medline]

Schafer KA 1998 The cell cycle: a review. Veterinary Pathology 35 461–478.[Abstract]

Speirs S & Kaufman MH 1990 Effect of maternal age on the incidence of digynic triploidy in LT/Sv strain mice: implications for the ovulation of primary and secondary oocytes in this strain. Journal of Experimental Zoology 253 83–87.

Stevens LC & Varnum DS 1974 The development of teratomas from parthenogenetically activated ovarian mouse eggs. Developmental Biology 37 369–380.[CrossRef][Web of Science][Medline]

Stojkovic M, Motlik J, Kolle S, Zakhartchenko V, Alberio R, Sinowatz F & Wolf E 1999 Cell-cycle control and oocyte maturation: review of literature. Reproduction in Domestic Animals 34 335–342.[Web of Science]

Taieb F, Thibier C & Jessus C 1997 On cyclins, oocytes, and eggs. Molecular Reproduction and Development 48 397–411.[CrossRef][Web of Science][Medline]

Verlhac MH, Kubiak JZ, Weber M, Geraud G, Colledge WH, Evans MJ & Maro B 1996 Mos is required for MAP kinase activation and is involved in microtubule organization during meiotic maturation in the mouse. Development 122 815–822.[Abstract]

Viveiros MM, Hirao Y & Eppig JJ 2001 Evidence that protein kinase C (PKC) participates in the meiosis I to meiosis II transition in mouse oocytes. Developmental Biology 235 330–342.[CrossRef][Web of Science][Medline]

West JD, Webb S & Kaufman MH 1993 Inheritance of a meiotic abnormality that causes the ovulation of primary oocytes and the production of digynic triploid mice. Genetical Research 62 183–193.[Web of Science][Medline]

Whittingham DG 1971 Culture of mouse ova. Journal of Reproduction and Fertility Supplement 14 7–21.


This article has been cited by other articles:


Home page
Biol. Reprod.Home page
A. Hupalowska, I. Kalaszczynska, S. Hoffmann, C. Tsurumi, J. Z. Kubiak, Z. Polanski, and M. A. Ciemerych
Metaphase I Arrest in LT/Sv Mouse Oocytes Involves the Spindle Assembly Checkpoint
Biol Reprod, December 1, 2008; 79(6): 1102 - 1110.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
C. A Everett, M. A Keighren, J. H Flockhart, and J. D West
Evaluation of triploid{leftrightarrow}diploid and trisomy-3{leftrightarrow}diploid mouse chimeras as models for investigating how lineage restriction occurs in confined placental mosaicism
Reproduction, December 1, 2007; 134(6): 799 - 809.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
N. Yoshida, M. Amanai, T. Fukui, E. Kajikawa, M. Brahmajosyula, A. Iwahori, Y. Nakano, S. Shoji, J. Diebold, H. Hessel, et al.
Broad, ectopic expression of the sperm protein PLCZ1 induces parthenogenesis and ovarian tumours in mice
Development, November 1, 2007; 134(21): 3941 - 3952.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Everett, C. A
Right arrow Articles by West, J. D
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Everett, C. A
Right arrow Articles by West, J. D


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS