| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
RESEARCH |
Departments of Human Anatomy and Genetics, University of Oxford, Oxford OX1 3QX, UK, 1 School of Animal and Microbial Sciences, University of Reading, Reading RG6 6AJ, UK, 2 Department of Physiology, Institute of Biomedicine, University of Turku 20502 Turku, Finland, 3 Institute of Reproductive and Developmental Biology, Imperial College London, Du Cane Road, London W12 0NN, UK and 4 Department of Pathology and Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030, USA
Correspondence should be addressed to R C Hirst; Email: rachel.hirst{at}anat.ox.ac.uk
| Abstract |
|---|
|
|
|---|
subunit mRNA levels significantly lower than normal. In these three mutants, however, mRNA levels for both the ßA and ßB subunits were extremely low compared with normal mice. At the protein level, neither inhibin A nor B was detected in the serum of these three mutants; however inhibin B, albeit at very low levels, was detectable within the ovaries. These observations confirm a major role for FSH in the control of transcription of the ßA and ßB genes but suggest that the constitutive transcription of the alpha subunit is less dependent on FSH. In contrast, in LH receptor knockout (LuRKO) female mice inhibin ßA subunit mRNA levels were similar to those measured in normal/heterozygous females but levels of inhibin
and ßB subunit mRNAs were significantly higher than in the normal group. This was reflected in significantly higher inhibin B protein levels in ovaries and serum. An inability to respond to LH combined with high circulating levels of FSH leads to a high proportion of antral follicles in LuRKO females, with granulosa cells constituting the major cell type within the ovary. The high percentage of antral granulosa cells is likely to account for the significantly higher levels of inhibin B production in these ovaries. | Introduction |
|---|
|
|
|---|
subunit linked to one of two ß subunits, ß A or ß B, to form either inhibin A or inhibin B. All three subunits are encoded by separate genes (Mason et al. 1985, Forage et al. 1986, Mayo et al. 1986). The name inhibin derives from the early observation that an aqueous testis extract could inhibit the appearance of castration cells in gonadectomized rats. It was subsequently shown that injections of follicular fluid could suppress pituitary follicle-stimulating hormone (FSH) secretion in rats (De Jong & Sharpe 1976, Schwartz & Channing 1977) and in 1985 inhibin was finally isolated from porcine and bovine follicular fluid (Ling et al. 1985, Robertson et al. 1985). In the female, inhibin has both endocrine and local actions within the ovary (Findlay 1994). Ovariectomy on any day of the rat estrous cycle induced a marked rise in serum FSH (DAgostino et al. 1989, Ackland et al. 1990) while long-term castration resulted in undetectable levels of inhibins in serum consistent with a gonadal origin for these hormones (Woodruff et al. 1996). Administration of recombinant inhibin to both female and male rats results in a decrease in circulating levels of FSH (Rivier et al. 1991, Woodruff et al. 1993), while in vitro FSH and estradiol independently increase inhibin production by rat granulosa cells in culture. In addition, inhibin A has been shown to stimulate luteinizing hormone (LH)-induced androgen production by rat (Hsueh et al. 1987), human (Hillier et al. 1991) and bovine (Wrathall & Knight 1995) thecal cells in culture. The development of assays which detect only dimeric forms of inhibin and discriminate between isoforms (Muttukrishna et al. 1994, Groome et al. 1996) has allowed the measurement of the biologically active inhibin proteins in both tissue and serum. Using such assays, Woodruff et al.(1996) detected both inhibin A and B in the serum of female rats and showed a differential secretion of inhibin A and B during the period of follicular development in the rat estrous cycle, suggesting either different sources or differering regulation of these hormones during this period. To investigate further the relationship between FSH and inhibins we have used a panel of female mice carrying mutations, both natural and genetically engineered which affect gonadotropin production or responsiveness and subsequently modify ovarian follicular development. We have measured inhibin subunit mRNA levels in the ovaries of these mice using quantitative real-time PCR and attempted to correlate these with ovarian histology and ovarian and serum inhibin protein levels, together with immunohistochemical localization of the inhibin subunit proteins within the ovaries.
| Materials and Methods |
|---|
|
|
|---|
Analysis of mutant mice
Mutations were identified by PCR analysis of tail DNA as previously described for hpg (Lang 1991) and LuRKO (Zhang et al. 2001) mice. For the FSHRKO mice the following primer pairs were used: forward GACTGATGCAG-GCCACCATT, reverse GCGTTCACCAGTCATGCGTA, and neo forward TGGCTACCCGTGATATTGCT; for the FSHß colony, primers within exon 3 were used to separate heterozygous from knockout mice: forward GATCTGGTGTA-TAAGGACCC and reverse CACGGTGCAGTCAGTGCTGT.
Tissue and serum collection
All procedures were carried out under anesthesia (Rompun:Ketaset: 0.1 ml/kg of a 20%:4% (v/v) solution; Veterinary Supplies, University of Oxford, Oxon, UK). Ovaries were dissected out, weighed and snap frozen in liquid nitrogen and stored at 70 °C. One ovary was used to extract RNA and the other to measure inhibin content. Blood was collected from the jugular sinus and serum was separated and frozen at 20 °C for assay. Ovaries taken from a further set of mice were collected for histological examination and immunohistochemistry.
Ovary extracts for inhibin assays
To prepare extracts for inhibin assay ovaries were placed in microfuge tubes containing 300 µl phosphate-buffered saline (pH 7.3) containing 1% BSA and sonicated for 1015 s using an ultrasonic tissue disintegrator (probe amplitude setting 8 µm peak to peak; MSE Instruments). After freezing and thawing homogenates were centrifuged for 5 min at 14 000 x g and supernatants were assayed without further dilution.
Hormone assays
Serum and gonadal inhibin A concentrations were measured using a previously reported two-site enzyme-linked immunosorbent assay (Muttukrishna et al. 1994). The detection limit was 2 pg recombinant human inhibin A/ml and within- and between-plate coefficients of variation were 3.5% and 9.2% respectively. Inhibin B was measured using a previously described two-site enzyme-linked immunosorbent assay (Groome et al. 1996) with a sensitivity of 30 pg recombinant inhibin B/ml and intra- and interassay coefficients of variation of 4.2% and 9.8% respectively. Mouse serum and ovary extract samples gave dilution curves in the inhibin A and B assays that were parallel to the recombinant human inhibin standards used.
Histology
For histological examination, ovaries and uteri were fixed overnight in Bouins solution, embedded in wax, and 10-µm sections were stained with hematoxylin and eosin.
Immunohistochemistry
Ovaries were fixed overnight in Bouins solution before embedding in Paraplast embedding medium. Sections (10 µm) were cut onto vectabond-treated slides, paraffin removed with xylene, followed by descending concentrations of ethanol. Sections were rehydrated and permeabilized with Tris-buffered saline (pH 7.4) containing 0.05% Triton X-100 for 15 min, blocked with 3% H2O2 for 10 min followed by Mouse on Mouse (M.O.M.) blocking reagent (Vector Laboratories, Peterborough, Cambridgeshire, UK) for 60 min. Sections were incubated in M.O.M. diluent for 5 min followed by incubation with the primary mouse monoclonal antibodies (neat supernatant): anti-human inhibin alpha subunit, anti-human inhibin beta B subunit and anti-human inhibin beta A (Bio-Oxford Innovation Ltd; Heyford Park, Oxon, UK) for 60 min.
Secondary antibody M.O.M. biotinylated anti-mouse IgG was applied for 10 min, followed by Vectastain ABC reagent for 5 min. Sections were then incubated in a 3,3'-diaminobenzidine (DAB) liquid substrate system (Sigma D7679) and counterstained with hematoxylin. Controls were performed in parallel. First, omission of the primary antibody incubation step, followed by subsequent secondary antibody and DAB incubations. Secondly, primary antibody incubation but omission of the secondary antibody incubation step. Positive specific staining was only detected in the situation where we had primary antibody followed by secondary antibody followed by DAB.
RNA extraction and cDNA synthesis
Total RNA was extracted with Trizol (Life Technologies, Paisley, Strathclyde, UK) and residual genomic DNA was removed by DNAse treatment (DNA-free, Ambion Inc supplied by AMS Biotechnology, Abingdon, Oxon, UK). DNAse-treated RNA was quantified by spectrophotometric measurement at
260 nm. One microgram RNA was reverse transcribed using Random decamers (Ambion) and Moloney murine leukemia virus reverse transcriptase (Life Technologies).
Measurement of inhibin mRNA levels
Quantitative real-time PCR (for a review see Bustin 2002), using the ABI 7700 was used to follow the gene expression of inhibin
, ß A and ß B subunits.
To measure cDNA levels a threshold cycle (Ct) was selected within the exponential phase of the amplification for all standards and samples. Arbitrary standards were generated by serial dilutions of a cDNA pool from normal mouse ovaries (representative of all stages of the estrous cycle). A standard curve was generated by plotting standards against Ct values, and sample values were read from this standard curve (Fig. 1
).
|
Primers and probes
Primers and probes were designed using Primer Express (Applied Biosystems, Warrington, Cheshire, UK) and are listed in Table 1
. Sequence information for each of the inhibin subunits was obtained by submission of the respective accession numbers to GenBank.
|
Statistical analysis
Differences between groups were analyzed by single-factor ANOVA, followed by Fishers post-hoc test. Differences where P values were <0.05 were considered statistically significant. Data for inhibin serum levels showed heterogeneity of variance and were normalized by logarithmic transformation before analysis.
| Results |
|---|
|
|
|---|
subunit mRNA levels were significantly lower in the ovaries of hpg females compared with levels in all other groups with the exception of FSHRKO females. Levels of inhibin
subunit mRNA did not differ between FSHß KO, FSHRKO and normal/heterozygous females but in the ovaries of the LuRKO females they were significantly higher than levels measured in the normal/heterozygous group (P < 0.05).
|
Inhibin ß B subunit mRNA levels were also low in the ovaries of FSHß KO, FSHRKO and hpg females and there were no significant differences between these groups. Significantly higher levels of inhibin ß B subunit were recorded in the ovaries of both LuRKO and normal/heterozygous females (P < 0.001) and mRNA levels in LuRKO ovaries were twice those recorded in normal/heterozygous females (P < 0.001).
Ovarian and uterine histology (Fig. 3
)
The ovaries of hpg females contain numerous small follicles located around the periphery and throughout the interstitial tissue. The ovaries of the FSHß KO and FSHRKO females show the same range of follicles, but like hpg ovaries lack antral follicles. The larger ovarian size in the FSHß KO and FSHRKO females is due to the increased amount of stromal tissue compared with the hpg ovary.
|
Uteri from all four mutant females were thin and threadlike and as shown in cross section showed little development of the luminal epithelium. In contrast, uteri from normal and heterozygous females were much larger with well developed luminal epithelium reflecting the presence of biologically active estrogen in the serum of these females.
Ovarian inhibin content (Table 2
)
Inhibin A
Levels of inhibin A were below the level of detection of the assay in the ovaries of FSHß KO, FSHRKO and hpg females. In contrast, inhibin A was detected in the ovaries of both LuRKO and normal/heterozygous females. There was no significant difference in ovarian inhibin A content between these two groups.
|
Serum inhibin concentrations (Table 3
)
Inhibin A
Serum levels of inhibin A were below the level of detection of the assay in all the FSHß KO, FSHRKO and hpg females assayed. In contrast, inhibin A was detected in the serum of 5/8 LuRKO and 17/29 normal/heterozygous females. In the LuRKO females, serum levels of inhibin A ranged from 9.3 to 14.6 pg/ml. In the normal/heterozygous group, levels ranged from 11.2 to 92.3 pg/ml. The data were log transformed to correct for the differences in heterogeneity between the two groups and analysis of this data showed a significant difference (P < 0.05) between LuRKO and normal/heterozygous females.
|
Inhibin B
Serum levels of inhibin B were also below the level of detection of the assay in all FSHß KO, FSHRKO and hpg females. However, serum levels of inhibin B were detectable in all LuRKO females and in 25/29 normal/heterozygous females. Mean levels of inhibin B were significantly higher in the LuRKO females (P < 0.001) compared with the normal/heterozygous group.
Ovarian inhibin immunohistochemistry (Fig. 4
)
Inhibin 
Positive staining for inhibin
was seen in the granulosa cells of all females in this study but was not detected in theca or interstitial tissue nor in the corpora lutea of the normal or heterozygote females. Positive staining was detected in granulosa cells at all stages of follicular development.
|
Inhibin ß B
Positive staining for inhibin ß B was only seen in ovaries from normal/heterozygous and LuRKO females and, as found for inhibin
, was restricted to granulosa cells.
| Discussion |
|---|
|
|
|---|
Expression of inhibin
in the ovaries of hpg and FSH mutant females was higher than that of the ß subunits indicating that basal, constitutive transcription of this gene is less dependent on FSH. In support of this, OShaughnessy and Gray (1995) found no difference in ovarian mRNA levels of inhibin
between hpg and normal females from days 1 to 15.
Synthesis of biologically active inhibin protein is dependent on dimerisation of
and ß subunits and the low levels of inhibin ß A subunit mRNA were reflected in undetectable levels of inhibin A protein within the ovary. In contrast, inhibin B protein was detectable within the ovaries of FSHß KO, FSHRKO and hpg females; therefore sufficient ß B protein must be formed to allow dimerization with the more abundant inhibin
subunit. In support of this finding both
and ß B but not ß A subunits have been detected in small follicles in the normal female rat, possibly representing follicles to be recruited in the following cycle (Meunier et al. 1988). However, ovarian content of inhibin ß B in the FSHß KO, FSHRKO and hpg females remained significantly lower than that measured in the ovaries of normal/heterozygous females and, in addition, inhibin B protein was not detected in the serum of any of the three mutants indicating that the amount of protein synthesized was not sufficient for the release of appreciable amounts into the bloodstream. In vitro studies in the rat found low levels of inhibin mRNAs in unstimulated granulosa cells in culture (Turner et al. 1989).
The early stages of follicular development have been shown to be gonadotropin independent (Kendall et al. 1991, 1995) and the FSHß KO, FSHRKO and hpg females reflect this in that all follicular stages up to pre-antral can be seen but antral and mature follicles have not been detected in these ovaries. Therefore, ovaries in which immature follicles predominate appear to produce very little biologically active inhibin. In support of this we have only been able to detect inhibin
but not ß B or ß A protein by immunohistochemistry in the ovaries of the FSHß KO, FSHRKO and hpg females.
In the LuRKO female significantly higher levels of ovarian expression of all three inhibin genes were seen compared with the FSHß KO, FSHRKO and hpg females. In this mutant, ovarian follicular development progresses beyond that seen in the FSH mutant and hpg females, reflecting the ability of this ovary to respond to the high levels of FSH in the circulation (Zhang et al. 2001). Therefore, granulosa cell stimulation by FSH allows significant upregulation of transcription of all three inhibin genes above basal levels. Rat granulosa cells in culture respond to FSH with a marked rise in mRNA levels of all three inhibin genes (Turner et al. 1989) and in the normal female rat coordinated expression of inhibins A and B was seen in follicles of the ovulatory pool (Meunier et al. 1988, Woodruff et al. 1988).
Ovarian expression of inhibin ß A subunit mRNA in the LuRKO females was similar to that seen in the ovaries of normal/heterozygous females, and ovarian content of inhibin A protein did not differ significantly between the two groups. However, the range of inhibin A levels in the serum of the LuRKO females was much lower than that seen in the normal/heterozygous females. In the normal female rat ß A subunit mRNA has been reported to increase progressively from newly recruited to preovulatory follicles, with the highest levels in large tertiary follicles in which granulosa cells have acquired LH receptors (Meunier et al. 1988, Arai et al. 2002). Serum inhibin levels in rats follow a pattern consistent with this during the estrous cycle (Fahy et al. 1995, Woodruff et al. 1996). This stage of follicular development is not reached in the LuRKO female and the levels of inhibin ß A mRNA and inhibin A protein in the individual pre-antral and antral follicles of the LuRKO female are likely to be lower than those attained in pre-ovulatory follicles.
In contrast, expression of both inhibin
and inhibin ß B subunit genes was significantly higher in ovaries from LuRKO females compared with that seen in normal/heterozygous ovaries and this was reflected in significantly higher ovarian and serum levels of inhibin B protein in the LuRKO females.
In the normal female, FSH output from the pituitary is regulated, in part, by ovarian estrogen (Richards 1980). Since serum FSH and LH are significantly elevated in LuRKO females (Zhang et al. 2001) and there is no evidence of biologically active estrogen in the circulation of LuRKO females as evidenced by the thin, atropic uteri, there is little or no estrogen regulation of either FSH or LH output from the pituitary. In the LuRKO female the high levels of FSH result in continuous follicular stimulation which cannot proceed to ovulation due to the inability of this ovary to respond to LH. As a result antral follicles occupy the majority of the ovary in the LuRKO female, and granulosa cells at a stage highly responsive to FSH constitute the predominant cell type in this ovary. In contrast, ovaries from normal/heterozygous females contain all stages of follicular development including mature follicles and also corpora lutea. Antral follicles and granulosa cells form a much smaller proportion of the overall tissue at any time. This difference may well account for the higher levels of inhibin
and ß B subunit mRNAs and inhibin B found in the LuRKO ovaries. Turner et al.(1989) showed that rat granulosa cells in culture responded not only to FSH but also to exogenous estrogen with an increase in mRNA levels of inhibin
and inhibin ß B but not inhibin ß A. The response to estrogen alone was several fold lower than that seen with FSH. Athough there is no evidence of estrogen in the circulation of LuRKO female mice, Zhang et al.(2001) reported measurable levels of estrogen in the ovaries of this mutant, although they were only 10% of those measured in wild-type mice. Intraovarian estrogen in the LuRKO female could therefore further increase transcription of the inhibin
and inhibin ß B genes and contribute to the higher levels of mRNA and protein levels of inhibin B relative to levels in normal/heterozygous mice.
Since inhibin ß B, but not ß A, is increased in the ovaries of the LuRKO females, there is likely to be differential regulation of these peptides within the follicle, with increased production of inhibin ß A occurring as LH augments the declining FSH levels in the circulation in the preovulatory phase (Woodruff et al. 1996). Our data indicate that increased levels of FSH can increase production of inhibin B in granulosa cells but that the high levels of ß A reported in the late follicular phase may require LH stimulation in addition.
In the rat, inhibin
mRNA has been detected in thecal and interstitial tissue and in cells of early corpora lutea (Hsu et al. 1995, Hsueh et al. 1987). In contrast, Woodruff et al.(1996) found no evidence of inhibin subunits in rat corpora lutea. In the ovaries of all females in this study we find unequivocal immunohistochemical staining for inhibin
only in the granulosa cells. Staining for inhibin ß B was only seen in ovaries from normal/heterozygous and LuRKO females and was also restricted to granulosa cells. Staining for ß A subunit could not be detected above background control sections. Interestingly, in the LuRKO ovary, where the highest levels of inhibin mRNAs and protein were detected, the LH-dependent stromal/interstitial compartment was minimal. Thus in the mouse we have no evidence for production of inhibins outwith the granulosa compartment. In a recent study in the sheep using in situ hybridization, expression of all inhibin subunits was also confined to the granulosa cells (Campbell & Baird 2001).
In summary, our findings in hpg, FSHß KO, FSHRKO and LuRKO female mice provide further evidence for FSH-dependent ovarian expression of all three inhibin subunit genes above basal levels. Paracrine actions of estrogen within the ovarian follicle appear to augment FSH-induced transcription of the inhibin genes but this study has shown that the major determinant of inhibin B synthesis within the ovary at any one time is the mass of FSH-responsive granulosa tissue, whereas additional stimulation by LH may be required for increased inhibin A synthesis. Synthesis of the inhibin subunits appears to be restricted to granulosa cells throughout the estrous cycle in the mouse and future work using laser capture micro-dissection of individual ovarian compartments in mutant and normal mice throughout development will allow confirmation of this together with identification of time of onset of inhibin synthesis.
| Acknowledgements |
|---|
|
|
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Abel MH, Wootton AN, Wilkins V, Huhtaniemi I, Knight PG & Charlton HM 2000 The effect of a null mutation in the follicle-stimulating hormone receptor gene on mouse reproduction. Endocrinology 141 17951803.
Ackland JF, DAgostino J, Ringstrom SJ, Hostetler JP, Mann BG & Schwartz NB 1990 Circulating radioimmunoassayable inhibin during periods of transient follicle-stimulating hormone rise: secondary surge and unilateral ovariectomy. Biology of Reproduction 43 347352.[Abstract]
Arai KY, Ohshima K, Watanabe G, Arai K, Uehara K & Taya K 2002 Dynamics of messenger RNAs encoding inhibin/activin subunits and follistatin in the ovary during the rat estrous cycle. Biology of Reproduction 66 11191126.
Bustin SA 2002 Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. Journal of Molecular Endocrinology 29 2339.[Abstract]
Campbell BK & Baird DT 2001 Inhibin A is a follicle stimulating hormone-responsive marker of granulosa cell differentiation, which has both autocrine and paracrine actions in sheep. Journal of Endocrinology 169 333345.[Abstract]
Cattanach BM, Iddon CA, Charlton HM, Chiappa SA & Fink G 1977 Gonadotrophin-releasing hormone deficiency in a mutant mouse with hypogonadism. Nature 269 338340.[CrossRef][Medline]
DAgostino J, Woodruff TK, Mayo KE & Schwartz NB 1989 Unilateral ovariectomy increases inhibin messenger ribonucleic acid levels in newly recruited follicles. Endocrinology 124 310317.
De Jong FH & Sharpe RM 1976 Evidence for inhibin-like activity in bovine follicular fluid. Nature 263 7172.[CrossRef][Medline]
Fahy PA, Wilson CA, Beard AJ, Groome NP & Knight PG 1995 Changes in inhibin-A (alpha-beta A dimer) and total alpha inhibin in the peripheral circulation and ovaries of rats after gonadotrophin-induced follicular development and during the normal oestrous cycle. Journal of Endocrinology 147 271283.
Findlay JK 1994 Peripheral and local regulators of folliculogenesis. Reproduction, Fertility and Development 6 127139.[CrossRef][Medline]
Forage RG, Ring JM, Brown RW, McInerney BV, Cobon GS, Gregson RP, Robertson DM, Morgan FJ, Hearn MT & Findlay JK 1986 Cloning and sequence analysis of cDNA species coding for the two subunits of inhibin from bovine follicular fluid. PNAS 83 30913095.
Groome NP, Illingworth PJ, OBrien M, Pai R, Rodger FE, Mather JP & McNeilly AS 1996 Measurement of dimeric inhibin B throughout the human menstrual cycle. Journal of Clinical Endocrinology and Metabolism 81 14011405.[Abstract]
Hillier SG, Yong EL, Illingworth PJ, Baird DT, Schwall RH & Mason AJ 1991 Effect of recombinant inhibin on androgen synthesis in cultured human thecal cells. Molecular and Cellular Endocrinology 75 R1R6.[CrossRef][Web of Science][Medline]
Hsu SY, Lai RJ, Nanuel D & Hsueh AJ 1995 Different 5'-flanking regions of the inhibin-alpha gene target transgenes to the gonad and adrenal in an age-dependent manner in transgenic mice. Endocrinology 136 55775586.[Abstract]
Hsueh AJ, Dahl KD, Vaughan J, Tucker E, Rivier J, Bardin CW & Vale W 1987 Heterodimers and homodimers of inhibin subunits have different paracrine action in the modulation of luteinizing hormone-stimulated androgen biosynthesis. PNAS 84 50825086.
Kendall SK, Saunders TL, Jin L, Lloyd RV, Glode LM, Nett TM, Keri RA, Nilson JH & Camper SA 1991 Targeted ablation of pituitary gonadotropes in transgenic mice. Molecular Endocrinology 5 20252036.
Kendall SK, Samuelson LC, Saunders TL, Wood RI & Camper SA 1995 Targeted disruption of the pituitary glycoprotein hormone alpha-subunit produces hypogonadal and hypothyroid mice. Genes and Development 9 20072019.
Kumar TR, Wang Y, Lu N & Matzuk MM 1997 Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nature Genetics 15 201204.[CrossRef][Web of Science][Medline]
Lang J 1991 Assay for deletion in GnRH (hpg) locus using PCR. Mouse Genome 89 857.
Ling N, Ying SY, Ueno N, Esch F, Denoroy L & Guillemin R 1985 Isolation and partial characterization of a Mw 32 000 protein with inhibin activity from porcine follicular fluid. PNAS 82 72177221.
Mason AJ, Hayflick JS, Ling N, Esch F, Ueno N, Ying SY, Guillemin R, Niall H & Seeburg PH 1985 Complementary DNA sequences of ovarian follicular fluid inhibin show precursor structure and homology with transforming growth factor-beta. Nature 318 659663.[CrossRef][Medline]
Mason AJ, Hayflick JS, Zoeller RT, Young WS 3rd, Phillips HS, Nikolics K & Seeburg PH 1986 A deletion truncating the gonadotropin-releasing hormone gene is responsible for hypogonadism in the hpg mouse. Science 234 13661371.
Mayo KE, Cerelli GM, Spiess J, Rivier J, Rosenfeld MG, Evans RM & Vale W 1986 Inhibin A-subunit cDNAs from porcine ovary and human placenta. PNAS 83 58495853.
Meunier H, Cajander SB, Roberts VJ, Rivier C, Sawchenko PE, Hsueh AJ & Vale W 1988 Rapid changes in the expression of inhibin alpha-, beta A-, and beta B-subunits in ovarian cell types during the rat estrous cycle. Molecular Endocrinology 2 13521363.
Muttukrishna S, Fowler PA, Groome NP, Mitchell GG, Robertson WR & Knight PG 1994 Serum concentrations of dimeric inhibin during the spontaneous human menstrual cycle and after treatment with exogenous gonadotrophin. Human Reproduction 9 16341642.
OShaughnessy PJ & Gray SA 1995 Gonadotropin-dependent and gonadotropin-independent development of inhibin subunit messenger ribonucleic acid levels in the mouse ovary. Endocrinology 136 20602065.[Abstract]
Richards JS 1980 Maturation of ovarian follicles: actions and interactions of pituitary and ovarian hormones on follicular cell differentiation. Physiology Reviews 60 5189.
Rivier C, Schwall R, Mason A, Burton L & Vale W 1991 Effect of recombinant inhibin on gonadotropin secretion during proestrus and estrus in the rat. Endocrinology 128 22232228.
Robertson DM, Foulds LM, Leversha L, Morgan FJ, Hearn MT, Burger HG, Wettenhall RE & de Kretser DM 1985 Isolation of inhibin from bovine follicular fluid. Biochemistry and Biophysics Research Communications 126 220226.[CrossRef]
Schwartz NB & Channing CP 1977 Evidence for ovarian inhibin: suppression of the secondary rise in serum follicle stimulating hormone levels in proestrous rats by injection of porcine follicular fluid. PNAS 74 57215724.
Turner IM, Saunders PT, Shimasaki S & Hillier SG 1989 Regulation of inhibin subunit gene expression by FSH and estradiol in cultured rat granulosa cells. Endocrinology 125 27902792.
Woodruff TK, DAgostino J, Schwartz NB & Mayo KE 1988 Dynamic changes in inhibin messenger RNAs in rat ovarian follicles during the reproductive cycle. Science 239 12961299.
Woodruff TK, Krummen LA, Lyon RJ, Stocks DL & Mather JP 1993 Recombinant human inhibin A and recombinant human activin A regulate pituitary and ovarian function in the adult female rat. Endocrinology 132 23322241.
Woodruff TK, Besecke LM, Groome N, Draper LB, Schwartz NB & Weiss J 1996 Inhibin A and inhibin B are inversely correlated to follicle-stimulating hormone, yet are discordant during the follicular phase of the rat estrous cycle, and inhibin A is expressed in a sexually dimorphic manner. Endocrinology 137 54635467.[Abstract]
Wrathall JH & Knight PG 1995 Effects of inhibin-related peptides and oestradiol on androstenedione and progesterone secretion by bovine theca cells in vitro. Journal of Endocrinology 145 491500.
Zhang FP, Poutanen M, Wilbertz J & Huhtaniemi I 2001 Normal prenatal but arrested postnatal sexual development of luteinizing hormone receptor knockout (LuRKO) mice. Molecular Endocrinology 15 172183.
This article has been cited by other articles:
![]() |
M H Abel, D Baban, S Lee, H M Charlton, and P J O'Shaughnessy Effects of FSH on testicular mRNA transcript levels in the hypogonadal mouse J. Mol. Endocrinol., April 1, 2009; 42(4): 291 - 303. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. H. Abel, P. J. Baker, H. M. Charlton, A. Monteiro, G. Verhoeven, K. De Gendt, F. Guillou, and P. J. O'Shaughnessy Spermatogenesis and Sertoli Cell Activity in Mice Lacking Sertoli Cell Receptors for Follicle-Stimulating Hormone and Androgen Endocrinology, July 1, 2008; 149(7): 3279 - 3285. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.R. Barnett, C. Schilling, C.R. Greenfeld, D. Tomic, and J.A. Flaws Ovarian follicle development and transgenic mouse models Hum. Reprod. Update, September 1, 2006; 12(5): 537 - 555. [Abstract] [Full Text] [PDF] |
||||
![]() |
C M Allan, Y Wang, M Jimenez, B Marshan, J Spaliviero, P Illingworth, and D J Handelsman Follicle-stimulating hormone increases primordial follicle reserve in mature female hypogonadal mice. J. Endocrinol., March 1, 2006; 188(3): 549 - 557. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, H. Newton, J. A. Spaliviero, C. M. Allan, B. Marshan, D. J. Handelsman, and P. J. Illingworth Gonadotropin Control of Inhibin Secretion and the Relationship to Follicle Type and Number in the hpg Mouse Biol Reprod, October 1, 2005; 73(4): 610 - 618. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |