| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
RESEARCH |
1 IVI foundation, (fIVI), C/Guadassuar no. 1, 46015 Valencia, Spain, 2 Department of Obstetrics and Gynaecology, School of Medicine, Valencia University, C/Blasco Ibañez, 17, 46010 Valencia, Spain and 3 Hospital Dr Peset, c/Gaspar Aguilar no. 15, 46020 Valencia, Spain
Correspondence should be addressed to A Pellicer, C/Guadassuar no. 1, 46015 Valencia, Spain; Email: apellicer{at}ivi.es
| Abstract |
|---|
|
|
|---|
All the hormones employed were as effective at triggering ovulation, with similar significant P values when compared with the control for which saline was used. The use of 10 IU LH resulted in significantly lower VP and VEGF expression than that seen in the groups treated with 10 IU hCG, 10 IU FSH or 60 IU LH. In conclusion, FSH and hCG, as well as a sixfold increase in LH, displayed similar biological activities, including increased VP due to excessive VEGF expression. The use of lower doses of LH produced similar rates of ovulation, while preventing the undesired changes in permeability. These experiments should therefore encourage clinicians to determine the optimal dose of LH to be employed in women in order to trigger ovulation and, at the same time, avoid the risk of OHSS.
| Introduction |
|---|
|
|
|---|
Due to the inconsistency of spontaneous LH surges and the wide use of gonadotrophin-releasing hormone (GnRH) analogues, human chorionic gonadotrophin (hCG) has been employed clinically for many years in assisted reproduction techniques, since there is a high degree of homology between LH and hCG. However, it is assumed that the biological activity of hCG is sixfold higher than LH, mainly due to its longer half-life and affinity for the common receptor (Yen et al. 1968).
The clinical use of hCG is associated with certain undesirable effects attributed to its biological power. One such example is ovarian hyperstimulation syndrome (OHSS), which is an hCG-dependent phenomenon (Lyons et al. 1994) mediated through the expression, production and secretion of vascular endothelial growth factor (VEGF) in human (Neulen et al. 1995, Wang et al. 2002) and rat (Gomez et al. 2002, 2003) granulosa cells.
Whether rLH and rFSH are responsible for inducing the same phenomenon is not known, but we do know that OHSS is mitigated, in part, in patients in whom the final preovulatory events have been triggered with rLH (The European Recombinant LH Study Group, 2001), or in whom a bolus of GnRH analogue has induced a spontaneous LH surge (Diedrich et al. 2001). Moreover, Manau et al.(2002) have recently shown that the circulatory dysfunction frequently seen in women undergoing controlled ovarian stimulation for assisted reproduction is less intense when rLH is employed instead of hCG.
The aim of the present study was to study the biological activity of hCG, rLH and rFSH in an attempt to determine the minimum effective dose for inducing ovulation and preventing OHSS in the rat model. With this in mind, two aspects were analyzed: their capacity to initiate follicular rupture and oocyte release, and their ability to simultaneously induce VEGF expression and vascular hyperpermeability, a phenomenon responsible for the clinical features of OHSS and linked to ovarian VEGF production (Gomez et al. 2002, 2003).
| Materials and Methods |
|---|
|
|
|---|
Animals, stimulation protocols and experimental design
Immature female Wistar rats were obtained from Harlam Iberica (Sant Feliu de Codina, Spain) and held in our laboratory for at least 1 week prior to initiating the experiments. They were fed a standard diet and allowed free access to water, and were kept in a 12 h light:12 h darkness schedule (lights on 07001900h). All studies were begun when the animals were 22 days old (4248 g) and were conducted in accordance with the NIH Guidelines for the Care and Use of Laboratory Animals. Protocols for animal handling were approved by the Ethical Animal Committee, School of Medicine of Valencia University.
All the animals employed in this study received 10 IU PMSG/day from day 22 to day 25. On day 26 they were included, depending on the drug and dose administered, in one of the five following groups.
Three sets of experiments were performed. Each set contained ten animals per group, and animals were killed at random at two stages: at 1720 h, following drug administration to trigger ovulation (Pellicer et al. 1988), half were analyzed for ovulation rates and then killed; vascular permeability (VP) and VEGF expression were measured in the remaining half 48 h after hCG, a time at which we had previously determined maximal VP and VEGF expression in hyperstimulated rats (Gómez et al. 2002, 2003). In each set of experiments, one ovary from at least two animals per group was frozen for mRNA analysis. After reverse transcription (RT) of isolated RNA, primers targeting the common region of VEGF isoforms were used in a real-time quantitative fluorescent PCR, in order to compare whole mRNA VEGF levels among the five groups and thereby identify differences in VEGF expression.
Induction of ovulation
After they had been killed, the tubes of each animal were isolated under the dissecting microscope and opened with a fine needle to obtain the oocytecumulus complexes in drops containing 80 IU/ml hyaluronidase. After 30 min, during which time the granulosa cells dispersed, the number of oocytes released in each tube were counted under the microscope (Pellicer et al. 1988).
VP assays
To measure VP, we employed a previously described method (Ujioka et al. 1997). Rats were anaesthetized with ketamine (100 mg/kg) and kept warm on a thermal blanket to avoid the risk of hypothermia. A fixed volume (0.2 ml) of 5 mM Evans Blue (EB; Sigma) dye diluted in distilled water was injected via the femoral vein. Thirty minutes after injection of the dye, the peritoneal cavity was filled with 5 ml 0.9% saline (21 °C, pH 6) and massaged for 30 s. Subsequently, the fluid was carefully extracted with a vascular catheter (Vialon; Becton Dickinson, Madrid, Spain) to prevent tissue or vessel damage. To avoid any protein interference, the peritoneal fluid was recovered in tubes containing 0.05 ml 0.1 M NaOH. After 12 min of centrifugation at 900 g, EB concentration was measured at 600 nm on a Shimadzu 1201 spectrophotometer (Izasa, Madrid, Spain). The level of the extravasated dye in the recovered fluid was expressed as µg EB/100 g body weight.
RNA isolation
RNA extraction was performed according to the method of Chomczynski & Sacchi (1987) with minor modifications, namely the use of the TRIZOL reagent. In short, each tissue was weighed and 500 µl TRIZOL reagent/ 100 mg tissue weight was added. Total RNA was separated from DNA and proteins by adding 250 µl chloroform, and precipitated with isopropanol (overnight at -20 °C). The precipitate was washed twice in ethanol, air-dried and resuspended in diethylpyrocarbonate (DEPC)-treated water. The amount of RNA was quantified by spectrophotometry with a SmartSpec 3000 spectrophotometer (BioRad, Barcelona, Spain).
RT
RT was performed using an Advantage RT-for-PCR KIT (Clontech, Palo Alto, CA, USA). The mastermix per sample was prepared as follows: 4 µl of 5 x reaction buffer, 1 µl dNTPs mix (10 mM each), 0.5 µl recombinant RNAse inhibitor and 1 µl Moloney murine leukemia virus reverse transcriptase. One microgram of each sample was diluted to a final volume of 12.5 µl in DEPC-treated water plus 1 µl oligo(dT)18. The mixture was then heated at 70 °C for 2 min, and kept on ice until the mastermix (6.5 µl) was added. For each RT, a blank was prepared using all the reagents except the RNA sample, for which an equivalent volume of DEPC-treated water (12.5 µl) was substituted. The RT blank was used to prepare the PCR blank (below). Once all components were mixed, the samples were incubated at 42 °C for 1 h, and heated at 94 °C for 5 min to stop cDNA synthesis and eliminate DNAse activity. The product was diluted to a final volume of 100 µl with DEPC-treated water and stored at -20 °C until PCR analysis.
Real-time PCR
Primers for quantitative PCR were designed using Primers Express Software (Applied Biosystems, Warrington, Cheshire, UK) and synthesized by Applied Biosystems (Barcelona, Spain). The ß-actin sense primer was 5'-616A GGGAAATCGTGCGTGACAT635-3' and the antisense ß-actin primer was 5'-764AACCGCTCATTGCCGATA-GT745-3' (NCBI access number 55574), giving rise to an expected PCR product of 149 bp. The VEGF primers designed to amplify a region common to all VEGF isoforms were 5'-114CAGCTATTGCCGTCCAATTGA124-3' for the sense primer and 5'-244CCAGGGCTTCATCATTGCA226-3' for the antisense primer where a 131 bp PCR product was expected (NCBI accession number AF215726
[GenBank]
).
To amplify cDNA, the RT samples were diluted to a final concentration of 12.5 pg total cDNA/µl. In each reaction, a total of 4 µl (50 pg cDNA) from each RT tube was mixed with 12.5 µl SYBR Green PCR master mix (Applied Biosystems) containing nucleotides, Taq DNA polymerase, MgCl2 and reaction buffer with SYBR green; 13 µl 0.25 µM specific primers and double-distilled water were added to a final volume of 25 µl.
Real-time PCR was performed using an ABI PRISM 7700 Sequence Detection System (Perkin Elmer Corp., Foster City, CA, USA), according to the manufacturers instructions, with a heated lid (105 °C), and with an initial 10-min denaturation at 95 °C, followed by 40 cycles at 95 °C for 15 s and at 60 °C for 1 min. Each sample was amplified in duplicate for VEGF and ß-actin, giving rise to four reactions per sample in each analysis. In parallel, sixfold serial dilutions of known concentrations of VEGF and ß-actin cDNA were run as a calibration curve. Quantification data were analyzed with ABI PRISM 1.7 analysis software. Background fluorescence was removed by setting a noise band. Duplicates showing more than a 5% variation were discarded. To validate real-time PCR, standard curves with r > 0.95 and slope values between -3.1 and -3.4 were required.
For each sample, the amounts of VEGF and ß-actin cDNA were determined in relation to the standard curves. VEGF/ß-actin was used to estimate and compare the relative VEGF expression among samples. The results of each PCR experiment were confirmed in a minimum of three consecutive experiments.
Final PCR products from VEGF and ß-actin were subjected to melting analysis to probe the presence of no more that one expected amplified product. A PCR cleanup kit (MO BIO Laboratories, Carlsbad, CA, USA) was used to eliminate primers and the recovered cDNA was sequenced to corraborate that the amplified bands corresponded with VEGF and ß-actin cDNA products.
Statistical analysis
Data are expressed as means±S.E.M. An ANOVA test was employed to evaluate the extent of oocyte recovery among groups, while post-hoc Tukey analysis defined significant P values in the hCG group compared with each of the other groups. For the VP and mRNA VEGF expression studies, non-parametrical tests were chosen because of the non-homogeneity and the high level of variance among the groups. In both cases, a KruskalWallis test, used to determine average differences among groups, was followed by a MannWhitney test for pair-wise comparisons when overall significance was detected. This allowed us to specifically define P values in the hCG group versus each of the other groups. Significance was defined in all cases as P < 0.05. Statistical analysis was carried out using the Statistical Package for Social Sciences (SPSS Inc., Chicago, IL, USA).
| Results |
|---|
|
|
|---|
|
|
|
| Discussion |
|---|
|
|
|---|
These experiments have shown that, in this model, a lower dose of LH may be employed to successfully induce ovulation without running the risk of provoking OHSS, providing the basis of a similar approach in humans. Whether the quality of the oocytes released in these conditions is optimal remains to be clarified. We have identified most of the oocytes at the metaphase II stage, but comparison of in vitro fertilization (IVF) and embryo development rates would be a further step towards understanding the advantages and disadvantages of different gonadotrophin doses.
Moreover, these experiments have been designed to demonstrate that, although the events triggered by the mid-cycle surge of LH and FSH are presented together, certain doses or biological activities of LH and FSH may be required in order for these events to take place. This has already been described in rabbits by Bomsel-Helm-reich et al.(1989), who have shown that lower doses of hCG induce nuclear maturation; luteinization required higher doses and it was only the highest dose of hCG that induced follicular rupture. This may also be the case in humans where a time- or dose-dependent phenomenon leads to the initial rise in progesterone 12 h before the LH surge, the complete maturation of the oocyte 32 h after the surge and follicular rupture 36 h after the LH surge (Hoff et al. 1983, Speroff et al. 1999, Yeh & Adashi 1999). Thus, it would be logical to determine the optimal rLH dose to induce ovulation and avoid OHSS.
Indeed, the experience accumulated in humans is contradictory. Initial multicentric studies have shown that a single dose of 15 000 IU rLH, comparable with 5000 IU hCG, is necessary to achieve optimal oocyte maturation in IVF and is more efficient than 5000 IU rLH (The European Recombinant LH Study Group 2001). These studies showed a reduced incidence of OHSS when 15 00030 000 IU rLH was employed as compared with hCG. A more recent publication, however, obtained the same number of mature oocytes and similar implantation rates in embryos derived from women treated with 5000 IU hCG or rLH (Manau et al. 2002), suggesting that the dose of rLH necessary to trigger oocyte maturation and avoid OHSS might be lower than initially expected. Moreover, the same authors showed that the haemodynamic changes associated with controlled ovarian stimulation in IVF are lower when rLH is employed, and that the overall incidence of OHSS is reduced (Manau et al. 2002).
The different drug doses were selected according to the minimal effective dose of hCG necessary for triggering optimal ovulation (Galway et al. 1990), lower doses of hCG having been found to be insufficient for these purposes (Chandrasekhar & Armstrong 1988, Dekel et al. 1995). The same dose was therefore employed for the other hormones tested (LH and FSH). Based on the biological activity of hCG being six times greater than that of LH, due to its longer half-life and affinity for the common receptor (Yen et al. 1968), a sixfold dose of LH was also administered.
The origin of the drugs used to induce ovulation, whether urinary or recombinant, may not have influenced the results of the study, since previous analyses in which hCG of both origins have been compared have provided similar biological responses (The European Recombinant Human Gonadotrophin Study Group 2000, Chang et al. 2001, Trinchard-Lugan et al. 2002).
A further interesting finding of the present study was the ability of rFSH to induce increased VP in hyperstimulated animals, a finding not previously reported. However, a very recent publication has described a familial mutation in the FSH receptor which allowed the binding of hCG and the development of spontaneous OHSS in pregnant women (Vasseur et al. 2003), raising interesting questions about the involvement of FSH in OHSS. Indeed, in our model, FSH also simultaneously induced VEGF expression, which has been reported in non-human primates (Christenson & Stouffer 1997) and human granulosa cells (Laitinen et al. 1997). Moreover, in this respect, FSH has been shown to be more potent than PMSG (Dissen et al. 1994) and LH (Wang et al. 2002). We know that, in animals, FSH drives many events at mid-cycle, such as oocyte maturation (Pellicer et al. 1989), luteinization, corpus luteum formation and follicular rupture (Galway et al. 1990, Montgomeri-Rice et al. 1993, Zelinski-Wooten et al. 1998). We have shown here that a dose of 10 IU rFSH has a biological activity similar to that of 10 IU hCG in inducing follicular rupture and increasing VP and VEGF expression. Thus, although the relevance of the mid-cycle surge of FSH in women with normal cycles is still a matter of speculation, the accumulated knowledge suggests two relevant physiological points. First, it is important in all the processes included in ovulation, which is reinforced by the finding of FSH receptors in human oocytes (Meduri et al. 2002). Secondly, the lower absolute serum levels described for FSH than for LH (Hoff et al. 1983, Speroff et al. 1999, Yeh & Adashi 1999) may reflect the different specific activity that both hormones display with regard to ovulation. In other words, lower FSH should be equally effective, a pathway that should be further explored in humans. Alternatively, the viability of a combination of FSH and LH should also be considered.
| Acknowledgements |
|---|
|
|
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Bomsel-Helmreich O, Huyen LN & Durand-Gasselin I 1989 Effects of varying doses of HCG on the evolution of preovulatory rabbit follicles and oocytes. Human Reproduction 4 636642.
Chandrasekhar Y & Armstrong DT 1988 Human chorionic gonadotropin and luteinizing hormone-releasing hormone reverse the blockade of ovulation in pregnant mares serum gonadotropin-primed immature rats by the anti-androgenic drug, hydroxyflutamide. Canadian Journal of Physiology and Pharmacology 66 783787.[Web of Science][Medline]
Chang P, Kenley S, Burns T, Denton G, Currie K, DeVane G & ODea L 2001 Recombinant human chorionic gonadotropin (rhCG) in assisted reproductive technology: results of a clinical trial comparing two doses of rhCG (Ovitrel) to urinary hCG (Profasi) for induction of final follicular maturation in in vitro fertilization-embryo transfer. Fertility and Sterility 76 6774.[CrossRef][Web of Science][Medline]
Chomczynski P & Sacchi N 1987 Single-step method of RNA isolation by acid guanidinium thiocyanatephenolchloroform extraction. Analytical Biochemistry 162 156159.[Web of Science][Medline]
Christenson LK & Stouffer RL 1997 Follicle-stimulating hormone and luteinizing hormone/chorionic gonadotropin stimulation of vascular endothelial growth factor production by macaque granulosa cells from pre- and periovulatory follicles. Journal of Clinical Endocrinology and Metabolism 82 21352142.
Dekel N, Ayalon D, Lewysohn O, Nevo N, Kaplan-Kraicer R & Shalgi R 1995 Experimental extension of the time interval between oocyte maturation and ovulation: effect on fertilization and first cleavage. Fertility and Sterility 64 10231028.[Web of Science][Medline]
Diedrich K, Ludwig M & Felberbaum RE 2001 The role of gonadotropin-releasing hormone antagonists in in vitro fertilization. Seminars in Reproductive Medicine 19 213220.[CrossRef][Web of Science][Medline]
Dissen GA, Lara HE, Fahrenbach WH, Costa ME & Ojeda SR 1994 Immature rat ovaries become revascularized rapidly after autotransplantation and show a gonadotropin-dependent increase in angiogenic factor gene expression. Endocrinology 134 11461154.
Galway AB, LaPolt PS, Tsafriri A, Dargan CM, Boine I & Hsueh AJ 1990 Recombinant follicle-stimulating hormone induces ovulation and tissue plasminogen activator expression in hypophysectomized rats. Endocrinology 127 30233028.
Gomez R, Simon C, Remohi J & Pellicer A 2002 Vascular endothelial growth factor receptor-2 activation induces vascular permeability in hyperstimulated rats, and this effect is prevented by receptor blockade. Endocrinology 143 43394348.
Gomez R, Simon C, Remohi J & Pellicer A 2003 Administration of moderate and high doses of gonadotropins to female rats increases ovarian vascular endothelial growth factor (VEGF) and VEGF receptor-2 expression that is associated to vascular hyperpermeability. Biology of Reproduction 68 21642171.
Hoff JD, Quigley ME & Yen SSC 1983 Hormonal dynamics at mid-cycle: a reevaluation. Journal of Clinical Endocrinology and Metabolism 57 792796.
Laitinen M, Ristimaki A, Honkasalo M, Narko K, Paavonen K & Ritvos O 1997 Differential hormonal regulation of vascular endothelial growth factors VEGF, VEGF-B, and VEGF-C messenger ribonucleic acid levels in cultured human granulosaluteal cells. Endocrinology 138 47484756.
Lyons CA, Wheeler CA, Frishman GN, Hackett RJ, Seifer DB & Haning RV Jr 1994 Early and late presentation of the ovarian hyperstimulation syndrome: two distinct entities with different risk factors. Human Reproduction 9 792799.
Manau D, Fabregues F, Arroyo V, Jimenez W, Vanrell JA & Balasch J 2002 Hemodynamic changes induced by urinary human chorionic gonadotropin and recombinant luteinizing hormone used for inducing final follicular maturation and luteinization. Fertility and Sterility 78 12611267.[CrossRef][Web of Science][Medline]
Meduri G, Charnaux N, Driancourt MA, Combettes L, Granet P, Vannier B et al. 2002 Follicle-stimulating hormone receptors in oocytes? Journal of Clinical Endocrinology and Metabolism 87 22662276.
Montgomery-Rice VC, Zusmanis K, Malter H & Mitchell-Leef D 1993 Pure FSH alone induces ovulation and subsequent pregnancy in the mouse resulting in fetal development. Life Sciences 53 3139.[CrossRef][Web of Science][Medline]
Neulen J, Yan Z, Raczek S, Weindel K, Keck C, Weich K et al. 1995 Human chorionic gonadotropin-dependent expression of vascular endothelial growth factor/vascular permeability factor in human granulosa cells: importance in ovarian hyperstimulation syndrome. Journal of Clinical Endocrinology and Metabolism 80 19671971.[Abstract]
Pellicer A, Palumbo A, De Cherney AH & Naftolin F 1988 Blockage of ovulation by an angiotensin antagonist. Science 240 16601661.
Pellicer A, Parmer TG, Stoane JM & Behrman HR 1989 Desensibilization to follicle-stimulating hormone in cumulus cells is coincident with hormone induction of oocyte maturation in rat follicle. Molecular and Cellular Endocrinology 64 179188.[CrossRef][Web of Science][Medline]
Speroff L, Glass RH & Kase NG 1999 Regulation of the menstrual cycle. In Clinical Gynecology, Endocrinology and Infertility, 6th edn, pp 201246. Baltimore, MD: Williams & Wilkins.
The European Recombinant Human Chorionic Gonadotrophin Study Group 2000 Induction of final follicular maturation and early luteinization in women undergoing ovulation induction for assisted reproduction treatment recombinant HCG versus urinary HCG. Human Reproduction 15 446451.
The European Recombinant LH Study Group 2001 Recombinant human luteinizing hormone is as effective as, but safer than, urinary human chorionic gonadotropin in inducing final follicular maturation and ovulation in in vitro fertilization procedures: results of a multicenter double-blind study. Journal of Clinical Endocrinology and Metabolism 86 26072618.
Trinchard-Lugan I, Khan A, Porchet HC & Munafo A 2002 Pharmacokinetics and pharmacodynamics of recombinant human chorionic gonadotrophin in healthy male and female volunteers. Reproductive Biomedicine Online 4 106115.[Medline]
Ujioka T, Matsuura K, Kawano T & Okamura H 1997 Role of progesterone in capillary permeability in hyperstimulated rats. Human Reproduction 12 16291634.
Vasseur C, Rodien P & Beau I et al. 2003 A chorionic gonadotropin-sensitive mutation in the follicle-stimulating hormone receptor as a cause of familial gestational spontaneous ovarian hyperstimulation syndrome. New England Journal of Medicine 349 753759.
Wang J, Luo F, Lu JJ, Chen PK, Liu P & Zheng W 2002 VEGF expression and enhanced production by gonadotropins in ovarian epithelial tumors. International Journal of Cancer 97 163167.
Yeh J & Adashi EY 1999 The ovarian life cycle. In Reproductive Endocrinology: Physiology, Pathophysiology and Clinical Management, 4th edn, pp 153190. Eds SSC Yen, RB Jaffe & RL Barbieri. Philadelphia, PA: WB Saunders Co.
Yen SSC, Llenera G, Little B & Pearson O 1968 Disappearance rate of endogenous luteinizing hormone and chorionic gonadotropin in man. Journal of Clinical Endocrinology and Metabolism 28 17631767.
Zelinski-Wooten MB, Hutchison JS, Hess DL, Wolf DP & Stouffer RL 1998 A bolus of recombinant human follicle stimulating hormone at midcycle induces periovulatory events following multiple follicular development in macaques. Human Reproduction 13 554560.
This article has been cited by other articles:
![]() |
S. R. Soares, R. Gomez, C. Simon, J. A. Garcia-Velasco, and A. Pellicer Targeting the vascular endothelial growth factor system to prevent ovarian hyperstimulation syndrome Hum. Reprod. Update, April 2, 2008; (2008) dmn008v1. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |